TkA08G003550 | RubberDandelionOmics

Gene overview

TkA08G003550

Reference: TK1151 Chr: Chr08 Coordinates: 907309-909015 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1422 bp · TkA08G003550|TK1151|cDNA

TTTGACTAGAGTAAAAGAATTATGAAATTTTTTGACAAGGCTAGGGATATAGCAGCAACAGAGCCAAAGAAAGTGATTCATTGTCTGAAAGTTGGCATTGCTCTTTCTGTGGTCTCACTTTTCTATTACATGAGACCGCTCTATGATGGTCTAGGTGGCAATGCAATGTGGGCTGTCATGACCGTGGTTGTAGCTCTTGAATACTCTGTTGGTGCGACAATAGCCAAGTCTTGTAATCGAGTAGGTGCCACTTTGGTGGC...

CDS

Download CDS FASTA

1287 bp · TkA08G003550|TK1151|CDS

ATGAAATTTTTTGACAAGGCTAGGGATATAGCAGCAACAGAGCCAAAGAAAGTGATTCATTGTCTGAAAGTTGGCATTGCTCTTTCTGTGGTCTCACTTTTCTATTACATGAGACCGCTCTATGATGGTCTAGGTGGCAATGCAATGTGGGCTGTCATGACCGTGGTTGTAGCTCTTGAATACTCTGTTGGTGCGACAATAGCCAAGTCTTGTAATCGAGTAGGTGCCACTTTGGTGGCGGGTTCCATAGGGCTCGGTGT...

Protein

Download Protein FASTA

428 aa · TkA08G003550|TK1151|PROTEIN

MKFFDKARDIAATEPKKVIHCLKVGIALSVVSLFYYMRPLYDGLGGNAMWAVMTVVVALEYSVGATIAKSCNRVGATLVAGSIGLGVHWMANQCGQELQPLILQVSVFILASVATFSRFIPCVKARFDYGAMVFILTFSFVSMSGYRVDKLLELARNRVSTISLGTSICILISMLFYPVWAGKELHDHIYQNLQNLADSLDGCVADYFNHDDESFHGKKEGYKCVLNSRAIQVAKANLASWEPAHGPFRYRHPWKQYLKV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA08G003550`
TK1151 ID	TkA08G003550
OH-1004 ID	LXL04_026634
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA08G003550

Location Chr08:907309-909015 (+)

Description Similar to ALMT10: Aluminum-activated malate transporter 10

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g00910`	Malate transporter.	No verified direct reference in this release
`At1g08440`	Malate transporter.	No verified direct reference in this release
`At3g11680`	Malate transporter.	No verified direct reference in this release
`At2g27240`	Malate transporter.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026634 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0010044 response to aluminum ion Biological Process

GO:0034220 monoatomic ion transmembrane transport Biological Process

GO:0071423 malate transmembrane transport Biological Process

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0009705 plant-type vacuole membrane Cellular Component

GO:0015140 malate transmembrane transporter activity Molecular Function

KEGG gene cross-reference

ath:AT1G08430

ath:AT1G08440

ath:AT2G27240

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.857

Rank 1 · TkA08G003550 · TK1151

Endoplasmic reticulum0.099

Rank 2 · TkA08G003550 · TK1151

Cytoplasm0.066

Rank 3 · TkA08G003550 · TK1151

Nucleus0.033

Rank 4 · TkA08G003550 · TK1151

Lysosome / Vacuole0.031

Rank 5 · TkA08G003550 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11744ALMT9-348 aa

PF13515FUSC_240-172 aa

PF04632FUSC47-204 aa

PF06081ArAE_147-175 aa

PF16240DUF4899307-416 aa

PF11744ALMT372-401 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA08G003550	`PF11744`	ALMT	9	348	1.7e-131	440.1
TkA08G003550	`PF13515`	FUSC_2	40	172	2.7e-08	34.7
TkA08G003550	`PF04632`	FUSC	47	204	1.1e-06	28.3
TkA08G003550	`PF06081`	ArAE_1	47	175	4.4	8.1
TkA08G003550	`PF16240`	DUF4899	307	416	0.14	12.1
TkA08G003550	`PF11744`	ALMT	372	401	1.7e-131	440.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O23086`	Arabidopsis thaliana	sp\|O23086\|ALMTA_ARATH Aluminum-activated malate transporter 10	52.000%	Swiss-Prot	High
`Q9SJE8`	Arabidopsis thaliana	sp\|Q9SJE8\|ALMT2_ARATH Aluminum-activated malate transporter 2	41.400%	Swiss-Prot	Medium
`Q9SRM9`	Arabidopsis thaliana	sp\|Q9SRM9\|ALMT8_ARATH Aluminum-activated malate transporter 8	41.300%	Swiss-Prot	Medium
`Q9XIN1`	Arabidopsis thaliana	sp\|Q9XIN1\|ALMT7_ARATH Aluminum-activated malate transporter 7	38.800%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card