RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G440930
Reference: TK1151 Chr: Chr07 Coordinates: 111688571-111691692 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2512 bp · TkA07G440930|TK1151|cDNA

TTAGATTTTAAAAATCTGATTTTTCCAGCTTCGAAATTCGAATATTGATTGTTGCTTTCACGTTGGTGTTCTACTGAACCACTCAATTACAAAAGCAATTGGAACTTGGGAGCGCTTTTCAATTTTCCAATTCAAACCCTTCCTTCTTCCACAATCTTTACTCATTTCTTCCACCACCACCACCGCCGCCGCCGATTTCATTTGCTCCGGCGAAACCGATAATCACAATGGTGACAAAACCCACAAAACCACCATCGCCA...

CDS

Download CDS FASTA

1986 bp · TkA07G440930|TK1151|CDS

ATGGTGACAAAACCCACAAAACCACCATCGCCACCGTCTTCACGATCATCTTCACTGTCTACTCATCTCGCTGTTGTAGAACTGAAACAAAGAATCCTGACATCACTTTCCAGACTCTCCGACCGAGACACCCACCAGATCGCCGTCGAAGACCTCGAAACCGTCATCCAGACACTCTCACCTGTCGTCTTTTCTATCATCCTCAACTCCCTCTACGAGGCCACTAACGACACCACCACCAACAAACCCGCCGTAAAAAA...

Protein

Download Protein FASTA

661 aa · TkA07G440930|TK1151|PROTEIN

MVTKPTKPPSPPSSRSSSLSTHLAVVELKQRILTSLSRLSDRDTHQIAVEDLETVIQTLSPVVFSIILNSLYEATNDTTTNKPAVKKEAIRLLSFLCATHTESAASHLTKIISHIVKRLKDPDSGVKDSCRESIGHLSFLYLKDSDSGDNKIGSLVSLFVKPLFDAMNEQNKAVQAGAASCMAKMVEMASDPPVLAFQKLCGRICKFLNSPNFMANSALLPVVSRLSQVGAISPQFLEPLLQSINDCLSSSDWSTRKSAA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G440930
TK1151 IDTkA07G440930
OH-1004 IDLXL04_030948
Relationship / confidenceRbh Sequence Supported / Probable
Protein identity (%)99.200
Protein coverage (%)TK1151 97.579 / OH-1004 74.568
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G440930
LocationChr07:111688571-111691692 (-)
DescriptionSimilar to TOR1: Microtubule-associated protein TORTIFOLIA1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g27060 Plant-specific microtubule-associated protein (MAP) that regulates the orientation of cortical microtubules and the direction of organ growth.
Arabidopsis SPIRAL2 promotes uninterrupted microtubule growth by suppressing the pause state of microtubule dynamics.2008 · DOI: 10.1242/jcs.030221
At1g50890 Plant-specific microtubule-associated protein (MAP) that regulates the orientation of cortical microtubules and the direction of organ growth.
Arabidopsis SPIRAL2 promotes uninterrupted microtubule growth by suppressing the pause state of microtubule dynamics.2008 · DOI: 10.1242/jcs.030221
At2g07170 TORTIFOLIA1-like protein 2. No verified direct reference in this release
At1g59850 TORTIFOLIA1-like protein 5. No verified direct reference in this release
At1g27210 TORTIFOLIA1-like protein 4. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_030948 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006886 intracellular protein transport Biological Process
GO:0009826 unidimensional cell growth Biological Process
GO:0010031 circumnutation Biological Process
GO:0090391 granum assembly Biological Process
GO:0170002 halotropism Biological Process
GO:0009507 chloroplast Cellular Component
GO:0009535 chloroplast thylakoid membrane Cellular Component
GO:0009570 chloroplast stroma Cellular Component
GO:0009941 chloroplast envelope Cellular Component
GO:0010005 cortical microtubule, transverse to long axis Cellular Component
GO:0055028 cortical microtubule Cellular Component
GO:0008017 microtubule binding Molecular Function
KEGG gene cross-reference
ath:AT1G50890
ath:AT1G50900
ath:AT4G27060
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.496
Rank 1 · TkA07G440930 · TK1151
Cytoplasm0.487
Rank 2 · TkA07G440930 · TK1151
Cell membrane0.095
Rank 3 · TkA07G440930 · TK1151
Endoplasmic reticulum0.058
Rank 4 · TkA07G440930 · TK1151
Golgi apparatus0.043
Rank 5 · TkA07G440930 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF24714TOR1L1_N26-308 aa
PF23271HEAT_GCN131-134 aa
PF25151TPR_Trm732_C31-56 aa
PF01602Adaptin_N35-134 aa
PF25808TPR_LAA1_C36-101 aa
PF12755Vac14_Fab1_bd39-82 aa
PF24987HEAT_EF3_N40-132 aa
PF07571TAF6_C52-124 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G440930PF24714TOR1L1_N263083.6e-111371.7
TkA07G440930PF23271HEAT_GCN1311341.1e-0526.3
TkA07G440930PF25151TPR_Trm732_C31560.0004320.9
TkA07G440930PF01602Adaptin_N351340.000121.8
TkA07G440930PF25808TPR_LAA1_C361010.07713.6
TkA07G440930PF12755Vac14_Fab1_bd39820.04215.2
TkA07G440930PF24987HEAT_EF3_N401322.7e-0628.2
TkA07G440930PF07571TAF6_C521240.0613.8
TkA07G440930PF25151TPR_Trm732_C631200.0004320.9
TkA07G440930PF25782TPR_CAND1671230.0005421.1
TkA07G440930PF25808TPR_LAA1_C671900.07713.6
TkA07G440930PF08064UME671190.4511.1
TkA07G440930PF12717Cnd1681345.7e-0936.9
TkA07G440930PF10363RTP1_C1731240.02615.3
TkA07G440930PF24573HEAT_DAAF5751330.0002421.5
TkA07G440930PF25801HEAT_GCN1_C_2781930.0009419.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9T041Arabidopsis thalianasp|Q9T041|TOR1_ARATH Microtubule-associated protein TORTIFOLIA141.700%Swiss-ProtMedium
F4I6M4Arabidopsis thalianasp|F4I6M4|TORL1_ARATH TORTIFOLIA1-like protein 142.700%Swiss-ProtMedium
F4IK92Arabidopsis thalianasp|F4IK92|TORL2_ARATH TORTIFOLIA1-like protein 237.300%Swiss-ProtLow
Q9XIE4Arabidopsis thalianasp|Q9XIE4|TORL5_ARATH TORTIFOLIA1-like protein 530.100%Swiss-ProtMedium
Q93ZH1Arabidopsis thalianasp|Q93ZH1|TORL4_ARATH TORTIFOLIA1-like protein 434.100%Swiss-ProtLow

JBrowse

View in Genome Browser