TkA07G437380 | RubberDandelionOmics

Gene overview

TkA07G437380

Reference: TK1151 Chr: Chr07 Coordinates: 110743965-110747219 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2088 bp · TkA07G437380|TK1151|cDNA

TTTACCCCTTTGATTAACCCTTAATCCCCATTCTCTCCTCCTCCACCAACCCCCGCCAACGATCAAGCCACCACCAACCTCCGCCATCCATCCATATAAGCATTTTTCCTCCTGAGCAATTCATAGTAGTCCACAGCAAACTCCACGAGCTCGATCATTTCTTATTTACCTCAAGGTTTATTTTCTCGATGGAGGCAAAGTCGGAGACCATTTTCCGATCACGGCTGCCGGACATTTACATACCCAAGCATCTCTCTTTG...

CDS

Download CDS FASTA

1620 bp · TkA07G437380|TK1151|CDS

ATGGAGGCAAAGTCGGAGACCATTTTCCGATCACGGCTGCCGGACATTTACATACCCAAGCATCTCTCTTTGCACGCGTATTGCTTTGAGAACATTGACAAGTTCAGTGACCGGCCGTGTTTGATTGACGGTGCCAGTGGTGTCGTGTACAGCTATGCTGACGTCGAGCTCACCTCGAGAAAGGTCGGTTCTGCCCTTCACAAACTAGGCATCGACAAGGGTGACGTCATCATGATTTTGCTCCCGAATTCGCCGGAGTT...

Protein

Download Protein FASTA

539 aa · TkA07G437380|TK1151|PROTEIN

MEAKSETIFRSRLPDIYIPKHLSLHAYCFENIDKFSDRPCLIDGASGVVYSYADVELTSRKVGSALHKLGIDKGDVIMILLPNSPEFVFSFLGASFIGAMSTMANPFFTSAEIIKQAKASGAKIIITQSAHAAKVKDFASENSIKVICIDSATEECLHFSELTSGDEKELPEVDISSDDVVALPYSSGTTGLPKGVMLTHKGLVTSVAQQVDGENPNLWIHSEDVLMCVLPLFHIYSLNSILLCGLRAGAGILIMQKFDI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G437380`
TK1151 ID	TkA07G437380
OH-1004 ID	LXL04_030858
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G437380`
Location	Chr07:110743965-110747219 (+)
Description	Similar to 4CL1: 4-coumarate--CoA ligase 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_030858` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0007623 circadian rhythm Biological Process GO:0009611 response to wounding Biological Process GO:0009698 phenylpropanoid metabolic process Biological Process GO:0009753 response to jasmonic acid Biological Process GO:0009800 cinnamic acid biosynthetic process Biological Process GO:0009803 cinnamic acid metabolic process Biological Process GO:0033494 ferulate metabolic process Biological Process GO:0052315 phytoalexin biosynthetic process Biological Process GO:0005829 cytosol Cellular Component GO:0005524 ATP binding Molecular Function GO:0016207 4-coumarate-CoA ligase activity Molecular Function GO:0016405 CoA-ligase activity Molecular Function
KEGG gene cross-reference	nta:107797004 nta:107803673 sot:102596056 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.471

Rank 1 · TkA07G437380 · TK1151

Peroxisome0.286

Rank 2 · TkA07G437380 · TK1151

Nucleus0.126

Rank 3 · TkA07G437380 · TK1151

Mitochondrion0.099

Rank 4 · TkA07G437380 · TK1151

Endoplasmic reticulum0.078

Rank 5 · TkA07G437380 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00501AMP-binding30-398 aa

PF13407Peripla_BP_4111-159 aa

PF13193AMP-binding_C306-324 aa

PF13193AMP-binding_C448-523 aa

PF13407Peripla_BP_4455-507 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G437380	`PF00501`	AMP-binding	30	398	1.2e-96	324.6
TkA07G437380	`PF13407`	Peripla_BP_4	111	159	0.098	12.9
TkA07G437380	`PF13193`	AMP-binding_C	306	324	1.1e-17	65.4
TkA07G437380	`PF13193`	AMP-binding_C	448	523	1.1e-17	65.4
TkA07G437380	`PF13407`	Peripla_BP_4	455	507	0.098	12.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card