TkA07G427180 | RubberDandelionOmics

Gene overview

TkA07G427180

Reference: TK1151 Chr: Chr07 Coordinates: 108055168-108056986 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

984 bp · TkA07G427180|TK1151|cDNA

AAAGCAACGAGAGAGAATTCATATTTCACAAGAAGCCACCGCCACCACTCTCACACCCCCTTTGTTTTCATCTCCTCCTTTGTTATCTTCTGCTACTTAATTCTTATGTCAGGAGAGAGAAAAAGTGATGATCATGATCATGAGATAATGGAAATCGAAGAAGAAACCTCACGCCAAAGCTGGCGGCGAGTCATGTCGCCGGAGATTGTGGAGGTCGAAGAGCACGAGAGCCGGAGCGCCATTACCAGAGACTCCGTCGA...

CDS

Download CDS FASTA

861 bp · TkA07G427180|TK1151|CDS

AAAGCAACGAGAGAGAATTCATATTTCACAAGAAGCCACCGCCACCACTCTCACACCCCCTTTGTTTTCATCTCCTCCTTTGTTATCTTCTGCTACTTAATTCTTATGTCAGGAGAGAGAAAAAGTGATGATCATGATCATGAGATAATGGAAATCGAAGAAGAAACCTCACGCCAAAGCTGGCGGCGAGTCATGTCGCCGGAGATTGTGGAGGTCGAAGAGCACGAGAGCCGGAGCGCCATTACCAGAGACTCCGTCGA...

Protein

Download Protein FASTA

286 aa · TkA07G427180|TK1151|PROTEIN

KATRENSYFTRSHRHHSHTPFVFISSFVIFCYLILMSGERKSDDHDHEIMEIEEETSRQSWRRVMSPEIVEVEEHESRSAITRDSVDVFVAVGKNDLDVVKWAVDHLVSPGARVYLVHVFPPVTHIQTPVGKLSRSQLSKDQVQIYINEENNKRRNLLQKYIRLCTDAKIVVETMLLESNTTTKAILDLIQVVNITSLVIGTKRSPSLRRLRKGPGKGEFIKKNAPSFCEVSIVCNGKQVTSSQPRQIVGISPSDIPTTS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G427180`
TK1151 ID	TkA07G427180
OH-1004 ID	LXL04_030739
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.300
Protein coverage (%)	TK1151 100.000 / OH-1004 98.282 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G427180`
Location	Chr07:108055168-108056986 (-)
Description	Similar to PUB36: U-box domain-containing protein 36
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_030739` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0016567 protein ubiquitination Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0009507 chloroplast Cellular Component GO:0004674 protein serine/threonine kinase activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0061630 ubiquitin protein ligase activity Molecular Function GO:0106310 protein serine kinase activity Molecular Function
KEGG gene cross-reference	ath:AT2G45910 ath:AT3G61390 ath:AT4G25160 ath:AT5G61550 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.438

Rank 1 · TkA07G427180 · TK1151

Cytoplasm0.356

Rank 2 · TkA07G427180 · TK1151

Nucleus0.333

Rank 3 · TkA07G427180 · TK1151

Endoplasmic reticulum0.070

Rank 4 · TkA07G427180 · TK1151

Lysosome / Vacuole0.044

Rank 5 · TkA07G427180 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00582Usp57-73 aa

PF00280potato_inhibit67-97 aa

PF00582Usp96-212 aa

PF03327Herpes_VP19C110-168 aa

PF02794HlyC110-159 aa

PF00280potato_inhibit125-151 aa

PF03371PRP38131-175 aa

PF00280potato_inhibit150-173 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G427180	`PF00582`	Usp	57	73	2.7e-07	32.0
TkA07G427180	`PF00280`	potato_inhibit	67	97	0.2	12.7
TkA07G427180	`PF00582`	Usp	96	212	2.7e-07	32.0
TkA07G427180	`PF03327`	Herpes_VP19C	110	168	0.058	13.6
TkA07G427180	`PF02794`	HlyC	110	159	0.2	12.2
TkA07G427180	`PF00280`	potato_inhibit	125	151	0.2	12.7
TkA07G427180	`PF03371`	PRP38	131	175	0.092	13.3
TkA07G427180	`PF00280`	potato_inhibit	150	173	0.2	12.7
TkA07G427180	`PF00280`	potato_inhibit	220	242	0.2	12.7
TkA07G427180	`PF03327`	Herpes_VP19C	227	251	0.058	13.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card