TkA07G427160 | RubberDandelionOmics

Gene overview

TkA07G427160

Reference: TK1151 Chr: Chr07 Coordinates: 108042048-108042599 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

552 bp · TkA07G427160|TK1151|cDNA

AACAATAGCGAAGAAGATGATGAGCTCAAACAGGCTTTGATTCCGGAACGGTTTGGAGATTCAACTTATTTAATAGATTCAATTGCTGTGGCTGAATTTGGGGGTAGATTGATTCATGAGTTACGTGGAAAAGGCAGCCATGGAAGACCTTCGGGATCCCTCGCTATTCAACGCGAGCCAATTGATCGAGCAGCCATTGAAGAAGTGATTAAGGTCGTGACTTGTTTCTATGAAGATAAAACCGAATGGGCTACCGGGTC...

CDS

Download CDS FASTA

552 bp · TkA07G427160|TK1151|CDS

AACAATAGCGAAGAAGATGATGAGCTCAAACAGGCTTTGATTCCGGAACGGTTTGGAGATTCAACTTATTTAATAGATTCAATTGCTGTGGCTGAATTTGGGGGTAGATTGATTCATGAGTTACGTGGAAAAGGCAGCCATGGAAGACCTTCGGGATCCCTCGCTATTCAACGCGAGCCAATTGATCGAGCAGCCATTGAAGAAGTGATTAAGGTCGTGACTTGTTTCTATGAAGATAAAACCGAATGGGCTACCGGGTC...

Protein

Download Protein FASTA

183 aa · TkA07G427160|TK1151|PROTEIN

NNSEEDDELKQALIPERFGDSTYLIDSIAVAEFGGRLIHELRGKGSHGRPSGSLAIQREPIDRAAIEEVIKVVTCFYEDKTEWATGSVEIFFSRNNALFTISKISTFNLQISRVKCMYDDEQEIKGKKMRMINLVSRSGCSEKKPRWKIGSFDMGFFFFFQFGSSVAIVEDFEKWSRSRKEKE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G427160`
TK1151 ID	TkA07G427160
OH-1004 ID	LXL04_036802
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	97.300
Protein coverage (%)	TK1151 100.000 / OH-1004 79.565 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G427160

Location Chr07:108042048-108042599 (-)

Description Similar to CSLD5: Cellulose synthase-like protein D5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g02730`	Involved in stem and root growth.	Disruption of ATCSLD5 results in reduced growth, reduced xylan and homogalacturonan synthase activity and altered xylan occurrence in Arabidopsis.2007 · DOI: 10.1111/j.1365-313x.2007.03281.x
`At5g16910`	Thought to be a Golgi-localized beta-glycan synthase that polymerize the backbones of noncellulosic polysaccharides (hemicelluloses) of plant cell wall.	No verified direct reference in this release
`At3g03050`	Thought to be a Golgi-localized beta-glycan synthase that polymerize the backbones of noncellulosic polysaccharides (hemicelluloses) of plant cell wall.	AtCSLD3, a cellulose synthase-like gene important for root hair growth in arabidopsis.2001 · DOI: 10.1104/pp.126.2.575

Rice

Reference gene ID	Possible function	Papers / DOI
`Os12g0555600`	Thought to be a Golgi-localized beta-glycan synthase that polymerize the backbones of noncellulosic polysaccharides (hemicelluloses) of plant cell wall.	No verified direct reference in this release
`UniProt: A2ZAK8`	Thought to be a Golgi-localized beta-glycan synthase that polymerize the backbones of noncellulosic polysaccharides (hemicelluloses) of plant cell wall.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_036802 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000919 cell plate assembly Biological Process

GO:0006970 response to osmotic stress Biological Process

GO:0009409 response to cold Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009625 response to insect Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009833 plant-type primary cell wall biogenesis Biological Process

GO:0030244 cellulose biosynthetic process Biological Process

GO:0042546 cell wall biogenesis Biological Process

GO:0048367 shoot system development Biological Process

GO:0048767 root hair elongation Biological Process

GO:0071555 cell wall organization Biological Process

KEGG gene cross-reference

ath:AT1G02730

ath:AT3G03050

ath:AT5G16910

dosa:Os10g0578200

dosa:Os12g0555600

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.427

Rank 1 · TkA07G427160 · TK1151

Cytoplasm0.385

Rank 2 · TkA07G427160 · TK1151

Cell membrane0.128

Rank 3 · TkA07G427160 · TK1151

Mitochondrion0.108

Rank 4 · TkA07G427160 · TK1151

Endoplasmic reticulum0.061

Rank 5 · TkA07G427160 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03552Cellulose_synt3-84 aa

PF03552Cellulose_synt83-101 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G427160	`PF03552`	Cellulose_synt	3	84	6.1e-14	52.2
TkA07G427160	`PF03552`	Cellulose_synt	83	101	6.1e-14	52.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SRW9`	Arabidopsis thaliana	sp\|Q9SRW9\|CSLD5_ARATH Cellulose synthase-like protein D5	36.600%	Swiss-Prot	Medium
`Q9LFL0`	Arabidopsis thaliana	sp\|Q9LFL0\|CSLD2_ARATH Cellulose synthase-like protein D2	35.900%	Swiss-Prot	Medium
`Q9M9M4`	Arabidopsis thaliana	sp\|Q9M9M4\|CSLD3_ARATH Cellulose synthase-like protein D3	35.900%	Swiss-Prot	Medium
`Q2QNS6`	Oryza sativa subsp. japonica	sp\|Q2QNS6\|CSLD4_ORYSJ Cellulose synthase-like protein D4	35.000%	Swiss-Prot	Medium
`A2ZAK8`	Oryza sativa subsp. indica	sp\|A2ZAK8\|CSLD1_ORYSI Cellulose synthase-like protein D1	35.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card