TkA07G414670 | RubberDandelionOmics

Gene overview

TkA07G414670

Reference: TK1151 Chr: Chr07 Coordinates: 104799679-104803067 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1419 bp · TkA07G414670|TK1151|cDNA

CGCAAAAGCTGATCAATGTTCTTCCTTCCCCCTTTTCTTCCTCCATAATCCCCTTCGTGTTTTTCTCTGATTCCAAATGCATACAGACATCAAAGAATTTCCATTGCAGTGATGAATTTCCAGAATCAATTGCAATATTTCTAACCCCCTCACTTCATAGATTTCTCGAATCATCAAATTCCATATATAATTAGCATATACACAATTGTATCTAAAATCGCTTCGATCGCCATTATCCTACCCATGATTTCTCAGAAAAC...

CDS

Download CDS FASTA

936 bp · TkA07G414670|TK1151|CDS

ATGGCTAATAGCACGGAAATCATGCTTACGAAAGTTAAGATCCCTCTTCCTGATATGGTGGCTGCAATTTTGGCTATGGATGAAAAGCTTATAGATTCCGATCAAGTAGAAAATTGTCTTAAATTATATCCCACGAAAGAAGAGATTGAGCAACTTAAGAATTTCACAGGTGATTATAATAAACTGCGCAAGCGTGAACAGTATGTCGTGGAGCTAATGAAGGTGCCACGTATGGACACTAAATTAAGGGTTTTTCTGTT...

Protein

Download Protein FASTA

312 aa · TkA07G414670|TK1151|PROTEIN

MANSTEIMLTKVKIPLPDMVAAILAMDEKLIDSDQVENCLKLYPTKEEIEQLKNFTGDYNKLRKREQYVVELMKVPRMDTKLRVFLFKMQFNPQVSQYKKNLNTVNSTCDEVRRSVKLKEIMKRILYLGNTLNQGTDRGAAVGFKLDSLLKLTDTRASNSKMTLMHYLCKVLASKSPTLLDFHKDLVSLEAATEIQMKVLAEEMQTILAGMEKANQELAASANDGPISEGFHKILKEFVGQAEAEMISVTNFYSVVCRNA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G414670`
TK1151 ID	TkA07G414670
OH-1004 ID	LXL04_030611
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 14.305 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G414670

Location Chr07:104799679-104803067 (+)

Description Similar to FH20: Formin-like protein 20

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q9FLQ7`	Formin-like protein 20.	No verified direct reference in this release
`At5g07645`	Putative formin-like protein 15b.	No verified direct reference in this release
`At5g07765`	Formin-like protein 21b.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0596300`	Formin-like protein 5.	No verified direct reference in this release
`UniProt: Q7XWS7`	Formin-like protein 12.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030611 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005737 cytoplasm Cellular Component

GO:0004721 phosphoprotein phosphatase activity Molecular Function

KEGG gene cross-reference

ath:AT5G07740

dosa:Os07g0596300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.724

Rank 1 · TkA07G414670 · TK1151

Cell membrane0.193

Rank 2 · TkA07G414670 · TK1151

Nucleus0.187

Rank 3 · TkA07G414670 · TK1151

Golgi apparatus0.054

Rank 4 · TkA07G414670 · TK1151

Endoplasmic reticulum0.038

Rank 5 · TkA07G414670 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02181FH22-290 aa

PF06133Com_YlbF26-114 aa

PF22927INT1_R3148-272 aa

PF06133Com_YlbF202-224 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G414670	`PF02181`	FH2	2	290	9.6e-87	292.2
TkA07G414670	`PF06133`	Com_YlbF	26	114	0.79	10.9
TkA07G414670	`PF22927`	INT1_R3	148	272	0.071	13.4
TkA07G414670	`PF06133`	Com_YlbF	202	224	0.79	10.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLQ7`	Arabidopsis thaliana	sp\|Q9FLQ7\|FH20_ARATH Formin-like protein 20	69.100%	Swiss-Prot	High
`P0C5K3`	Arabidopsis thaliana	sp\|P0C5K3\|FH15B_ARATH Putative formin-like protein 15b	59.500%	Swiss-Prot	High
`P0C5K5`	Arabidopsis thaliana	sp\|P0C5K5\|FH21B_ARATH Formin-like protein 21b	58.600%	Swiss-Prot	High
`Q84ZL0`	Oryza sativa subsp. japonica	sp\|Q84ZL0\|FH5_ORYSJ Formin-like protein 5	65.500%	Swiss-Prot	High
`Q7XWS7`	Oryza sativa subsp. japonica	sp\|Q7XWS7\|FH12_ORYSJ Formin-like protein 12	61.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card