TkA07G411300 | RubberDandelionOmics

Gene overview

TkA07G411300

Reference: TK1151 Chr: Chr07 Coordinates: 103921380-103924226 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1787 bp · TkA07G411300|TK1151|cDNA

TCGTAAATGGACATCTAGGCACCCCATTTTATTTTTTACAGAATTATACTCCCAGTTTTTGTGTAGTAGAGATATTTCTCATTTCATGATCACTCTCTCCCTCATACTTTTCTAGAGAGAGAAACAAAAGTCGGCAAATGTGAGCTCAATTCCACCAAAATCCGGTGACAGTTTCGTATTTTAGTTTCAATTTCTTCGAGTTTACGAAATCAGGTGTGCTTTTTTGGTGGAATTTGTTTCTATCTGGTAAGAAATGCAGG...

CDS

Download CDS FASTA

990 bp · TkA07G411300|TK1151|CDS

ATGCAGGATATACATTCAATTGGAAGTGGTGGTGGAGGAGGAGGGAGGTTGTTCGGCGGCGGCGGTGGGGATAGACGTTTGAGACCGCACCACCACCATCAAGGGCACGGACCACAGGCTTTGAAATGCCCGCGTTGTGAGTCGCTGAACACGAAATTCTGTTACTACAACAACTATAATCTCTCTCAGCCACGTCATTTCTGTAAGAGCTGCCGGCGATACTGGACCAAAGGTGGTGTACTCCGTAACGTCCCCGTAGG...

Protein

Download Protein FASTA

329 aa · TkA07G411300|TK1151|PROTEIN

MQDIHSIGSGGGGGGRLFGGGGGDRRLRPHHHHQGHGPQALKCPRCESLNTKFCYYNNYNLSQPRHFCKSCRRYWTKGGVLRNVPVGGGCRKTKRSKHKSTNNNPSSDTTVRKSSNSQNSSSDSSSLTANTTTANTKAKTSTAAPVTAAEVLSGIDSTNSAPTLLNFQESSSRFLNPSFDPPLLNQSSAENIFPEIGTFTSLITSSTGQLPLGFNIADDISPFRLHHTAHVVENSNTNHQQWMHTDHTMEDDLKVQDTGP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G411300`
TK1151 ID	TkA07G411300
OH-1004 ID	LXL04_031481
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	54.500
Protein coverage (%)	TK1151 89.362 / OH-1004 89.123 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G411300

Location Chr07:103921380-103924226 (+)

Description Similar to DOF5.4: Dof zinc finger protein DOF5.4

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g60850`	Transcription factor that binds specifically to a 5'-AA[AG]G-3' consensus core sequence.	No verified direct reference in this release
`At5g65590`	Transcription factor that binds specifically to a 5'-AA[AG]G-3' consensus core sequence.	No verified direct reference in this release
`At5g60200`	Transcription factor that binds specifically to a 5'-AA[AG]G-3' consensus core sequence (By similarity).	Mobile PEAR transcription factors integrate positional cues to prime cambial growth.2019 · DOI: 10.1038/s41586-018-0839-y
`At3g21270`	Transcription factor that binds specifically to a 5'-AA[AG]G-3' consensus core sequence.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0726300`	Transcription factor that may transactivate seed storage protein genes in developing seeds.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_031481 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0010052 guard cell differentiation Biological Process

GO:0010118 stomatal movement Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:1902066 regulation of cell wall pectin metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0000976 transcription cis-regulatory region binding Molecular Function

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0008270 zinc ion binding Molecular Function

GO:0043565 sequence-specific DNA binding Molecular Function

KEGG gene cross-reference

ath:AT1G51700

ath:AT5G60850

ath:AT5G65590

dosa:Os02g0726300

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.943

Rank 1 · TkA07G411300 · TK1151

Cytoplasm0.178

Rank 2 · TkA07G411300 · TK1151

Mitochondrion0.018

Rank 3 · TkA07G411300 · TK1151

Cell membrane0.018

Rank 4 · TkA07G411300 · TK1151

Endoplasmic reticulum0.010

Rank 5 · TkA07G411300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23451Zn_ribbon_PaaD31-72 aa

PF02701Zn_ribbon_Dof39-95 aa

PF28191UBAP1-MVB12_assoc93-173 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G411300	`PF23451`	Zn_ribbon_PaaD	31	72	0.0066	16.8
TkA07G411300	`PF02701`	Zn_ribbon_Dof	39	95	1.2e-33	115.8
TkA07G411300	`PF28191`	UBAP1-MVB12_assoc	93	173	0.02	15.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LDR0`	Arabidopsis thaliana	sp\|Q8LDR0\|DOF54_ARATH Dof zinc finger protein DOF5.4	43.800%	Swiss-Prot	Medium
`Q9LSL6`	Arabidopsis thaliana	sp\|Q9LSL6\|DOF57_ARATH Dof zinc finger protein DOF5.7	86.200%	Swiss-Prot	Low
`Q84TE9`	Arabidopsis thaliana	sp\|Q84TE9\|DOF53_ARATH Dof zinc finger protein DOF5.3	84.200%	Swiss-Prot	Low
`Q94AR6`	Arabidopsis thaliana	sp\|Q94AR6\|DOF31_ARATH Dof zinc finger protein DOF3.1	86.700%	Swiss-Prot	Low
`Q6Z345`	Oryza sativa subsp. japonica	sp\|Q6Z345\|DOF4_ORYSJ Dof zinc finger protein 4	94.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card