TkA07G410050 | RubberDandelionOmics

Gene overview

TkA07G410050

Reference: TK1151 Chr: Chr07 Coordinates: 103541131-103544310 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1826 bp · TkA07G410050|TK1151|cDNA

GGAGAAATAATAATGCCAAAACTTTGTTTGTAGTGAAGATAAATTTATTTTTTGATTTCAATTTCCAAAATTTCATCATTCAAACGAATAACATTTCAGAAGTGAGAAGAATCTTTATTAATGGCACCCACTCGATAAACAAGTTTCTGATTTTCTTCTTCTAATGAACCCTAACGAGTAATCAATCACTCTTCAATTTGGGAAATTTTCTAGGGCTCCGGTGTTCGAATTCAGTCGGTCTGTGCGTTTCGTATGATTGT...

CDS

Download CDS FASTA

1416 bp · TkA07G410050|TK1151|CDS

ATGATTGTAAGGAAAGATATGAGCTGGCGAAGAGTAGCGAACTCCTTACAGGCTTTTTCTGCTCATACTGCACTGTTTTGCTTCACGCTTTTGCTTGTTCTTAAACTCGATCATCTTGTTTCCTACTCCTGGTGGGTCATATTCTTCCCGCTTTTCGTATTTCACGCTGTTGTTGCCCGAGGAAGATTCTCATTACCTGCACCATCAGTTCCCCATGGCCGTGATTGGGCGCCATGTCATGCAGTTGTCGCCACACCTTT...

Protein

Download Protein FASTA

471 aa · TkA07G410050|TK1151|PROTEIN

MIVRKDMSWRRVANSLQAFSAHTALFCFTLLLVLKLDHLVSYSWWVIFFPLFVFHAVVARGRFSLPAPSVPHGRDWAPCHAVVATPLLIAFEILLCVFLENRHVTKPPAVSLQIVFLPLLAFEVAILVDNFRMCKALLPGDDESVSDDAIWETLPHFWVAISMVFFIAATVFTLLKLSGFVDALGWWDLLINFGIAECFSFLVCTKWSNPVIHRNTETRESASSSSNAIRYLDWNSGLVVSSDDSNSEDQICSLQDVGGH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G410050`
TK1151 ID	TkA07G410050
OH-1004 ID	LXL04_038206
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	51.100
Protein coverage (%)	TK1151 9.979 / OH-1004 4.612 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G410050`
Location	Chr07:103541131-103544310 (-)
Description	Similar to KIN7D: Kinesin-like protein KIN-7D, mitochondrial
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_038206` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0007018 microtubule-based movement Biological Process GO:0031347 regulation of defense response Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005739 mitochondrion Cellular Component GO:0005871 kinesin complex Cellular Component GO:0005874 microtubule Cellular Component GO:0009507 chloroplast Cellular Component GO:0003777 microtubule motor activity Molecular Function GO:0005524 ATP binding Molecular Function GO:0008017 microtubule binding Molecular Function GO:0008270 zinc ion binding Molecular Function
KEGG gene cross-reference	ath:AT2G21380 ath:AT4G39050 osa:9271714 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.322

Rank 1 · TkA07G410050 · TK1151

Golgi apparatus0.267

Rank 2 · TkA07G410050 · TK1151

Lysosome / Vacuole0.227

Rank 3 · TkA07G410050 · TK1151

Cytoplasm0.189

Rank 4 · TkA07G410050 · TK1151

Cell membrane0.162

Rank 5 · TkA07G410050 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10269Tmemb_185A34-296 aa

PF28839F59B103_C87-103 aa

PF28839F59B103_C266-279 aa

PF13920zf-C3HC4_3421-464 aa

PF14447Prok-RING_4424-465 aa

PF21362Sina_RING424-458 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G410050	`PF10269`	Tmemb_185A	34	296	2.2e-92	310.0
TkA07G410050	`PF28839`	F59B103_C	87	103	0.11	12.8
TkA07G410050	`PF28839`	F59B103_C	266	279	0.11	12.8
TkA07G410050	`PF13920`	zf-C3HC4_3	421	464	2.5e-11	43.9
TkA07G410050	`PF14447`	Prok-RING_4	424	465	0.052	14.2
TkA07G410050	`PF21362`	Sina_RING	424	458	10.0	7.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card