TkA07G396240 | RubberDandelionOmics

Gene overview

TkA07G396240

Reference: TK1151 Chr: Chr07 Coordinates: 99531235-99532073 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

534 bp · TkA07G396240|TK1151|cDNA

ATGCCGCTTCAAACGTCATACGAGAAAAAACATGAAATTAGTTCCGTAAAAGCTCTGTTGTGGTTTGGATTAGCAATCGGTGTTCTTGAGATCCTATCACTACTCGTTTTCCTTTATATAACTTACAGAGATTCAACCACAACTGCAAAAAGCTACTTCCCAATAGCTTCATCGTTCAAAAGGTTCACATACAGAGAGCTGAAAACCGCAACACACAATTTCCGAGAAGAGATAGGGAGAGGTGGCGCTGGTGTGGTTTA...

CDS

Download CDS FASTA

534 bp · TkA07G396240|TK1151|CDS

ATGCCGCTTCAAACGTCATACGAGAAAAAACATGAAATTAGTTCCGTAAAAGCTCTGTTGTGGTTTGGATTAGCAATCGGTGTTCTTGAGATCCTATCACTACTCGTTTTCCTTTATATAACTTACAGAGATTCAACCACAACTGCAAAAAGCTACTTCCCAATAGCTTCATCGTTCAAAAGGTTCACATACAGAGAGCTGAAAACCGCAACACACAATTTCCGAGAAGAGATAGGGAGAGGTGGCGCTGGTGTGGTTTA...

Protein

Download Protein FASTA

177 aa · TkA07G396240|TK1151|PROTEIN

MPLQTSYEKKHEISSVKALLWFGLAIGVLEILSLLVFLYITYRDSTTTAKSYFPIASSFKRFTYRELKTATHNFREEIGRGGAGVVYKGKLPDDRIAAIKMLKEVNIHHGEAEFQAEISTIGKLNHMNLIETWGYCIEGKHRLVVYEFMENGSLAANLNSNKLDWGKKLQIAIATGC

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G396240`
TK1151 ID	TkA07G396240
OH-1004 ID	LXL04_030307
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	98.300
Protein coverage (%)	TK1151 98.870 / OH-1004 14.451 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G396240

Location Chr07:99531235-99532073 (-)

Description Similar to PK1: Putative receptor protein kinase ZmPK1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g24080`	G-type lectin S-receptor-like serine/threonine-protein kinase At5g24080.	No verified direct reference in this release
`At1g60800`	Receptor kinase acting, redundantly with other CIKs (e.g. CIK1, CIK2, CIK3, CIK5 and CIK6), as a coreceptor of CLV1, CLV2/CRN and RPK2, and required for CLAVATA-family peptides (e.g. CLV3) signaling through phosphorylation; this signaling regulates protophloem differentiation and the maintenance of shoot apical meristem (SAM) and root apical meristem (RAM) homeostasis, and acts down-stream of BRX and OPS.	No verified direct reference in this release
`At3g02810`	Involved in pollen tube guidance into micropyle.	No verified direct reference in this release
`At5g45780`	Receptor kinase acting, redundantly with other CIKs (e.g. CIK1, CIK2, CIK3, CIK5 and CIK6), as a coreceptor of CLV1, CLV2/CRN and RPK2, and required for CLAVATA-family peptides (e.g. CLV3, CLE25, CLE26 and CLE45) signaling through phosphorylation; this signaling regulates protophloem differentiation and the maintenance of shoot apical meristem (SAM) and root apical meristem (RAM) homeostasis, and acts down-stream of BRX and OPS.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030307 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006468 protein phosphorylation Biological Process

GO:0006952 defense response Biological Process

GO:0048544 recognition of pollen Biological Process

GO:0051707 response to other organism Biological Process

GO:0005576 extracellular region Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0016020 membrane Cellular Component

GO:0004672 protein kinase activity Molecular Function

GO:0004674 protein serine/threonine kinase activity Molecular Function

GO:0005516 calmodulin binding Molecular Function

GO:0005524 ATP binding Molecular Function

KEGG gene cross-reference

ath:AT1G34300

ath:AT4G00340

ath:AT5G24080

zma:542378

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.822

Rank 1 · TkA07G396240 · TK1151

Endoplasmic reticulum0.104

Rank 2 · TkA07G396240 · TK1151

Cytoplasm0.075

Rank 3 · TkA07G396240 · TK1151

Nucleus0.046

Rank 4 · TkA07G396240 · TK1151

Lysosome / Vacuole0.034

Rank 5 · TkA07G396240 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07714PK_Tyr_Ser-Thr74-172 aa

PF00069Pkinase75-161 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G396240	`PF07714`	PK_Tyr_Ser-Thr	74	172	1.1e-15	58.4
TkA07G396240	`PF00069`	Pkinase	75	161	2.4e-14	54.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FLV4`	Arabidopsis thaliana	sp\|Q9FLV4\|Y5248_ARATH G-type lectin S-receptor-like serine/threonine-protein kinase At5g24080	40.400%	Swiss-Prot	Medium
`Q93ZS4`	Arabidopsis thaliana	sp\|Q93ZS4\|CIK1_ARATH Protein CLAVATA3 INSENSITIVE RECEPTOR KINASE 1	43.100%	Swiss-Prot	Medium
`Q9M8S2`	Arabidopsis thaliana	sp\|Q9M8S2\|LIPG2_ARATH Receptor-like kinase LIP2	45.200%	Swiss-Prot	Medium
`C0LGU5`	Arabidopsis thaliana	sp\|C0LGU5\|CIK4_ARATH Protein CLAVATA3 INSENSITIVE RECEPTOR KINASE 4	43.000%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card