Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1949 bp · TkA07G396230|TK1151|cDNA
AAAGTGCTTTGCAAAGACTCAAAAACAGTTCTGAAAGGGTTTTGCAAGCCCTGTGTCAATGCCCGCTCTTCCTCTTCTTCAAAACTTAAAAACAAAGAAAATACACGCTGCTCCTCTTTCTTGTTCGTGAAACCTTTCCATCGTCGCTCTCTATCTCACCGGTATCCCCCTTCACACCGTCGGAGGAGTCCAGAAGTCGTAGCCGCCGCTCTCCTCTCCGCCGGCCTCTCCACTCGTCCTGTCCGCCGTCTGGTAGCCTT...
897 bp · TkA07G396230|TK1151|CDS
AAAGTGCTTTGCAAAGACTCAAAAACAGTTCTGAAAGGGTTTTGCAAGCCCTGTGTCAATGCCCGCTCTTCCTCTTCTTCAAAACTTAAAAACAAAGAAAATACACGCTGCTCCTCTTTCTTGTTCGTGAAACCTTTCCATCGTCGCTCTCTATCTCACCGGTATCCCCCTTCACACCGTCGGAGGAGTCCAGAAGTCGTAGCCGCCGCTCTCCTCTCCGCCGGCCTCTCCACTCGTCCTGTCCGCCGTCTGGTAGCCTT...
Protein
Download Protein FASTA298 aa · TkA07G396230|TK1151|PROTEIN
KVLCKDSKTVLKGFCKPCVNARSSSSSKLKNKENTRCSSFLFVKPFHRRSLSHRYPPSHRRRSPEVVAAALLSAGLSTRPVRRLVAFSTCPLPVMSLSSPSPVTSVSGKPLPPTPLSPPAAVTSSDTSLCSPSQIMETQDHPNSSVPQEVCESAKLGDLILECIGRVSLTSGVNVINRLESSEVSVKEETQKIGDDLEESEESESESEEDSSSSSSSSSSSDDDDDDDDDEEVEEEEEEEEEEKGSQKVKKVNSNVETEE...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G396230 |
|---|---|
| TK1151 ID | TkA07G396230 |
| OH-1004 ID | LXL04_030307 |
| Relationship / confidence | Non Reciprocal Best Hit / Complex relationship |
| Protein identity (%) | 95.500 |
| Protein coverage (%) | TK1151 67.785 / OH-1004 16.680Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G396230 |
|---|---|
| Location | Chr07:99527611-99529790 (-) |
| Description | Similar to PK1: Putative receptor protein kinase ZmPK1 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006468 protein phosphorylation Biological Process GO:0006952 defense response Biological Process GO:0048544 recognition of pollen Biological Process GO:0051707 response to other organism Biological Process GO:0005576 extracellular region Cellular Component GO:0005634 nucleus Cellular Component GO:0005886 plasma membrane Cellular Component GO:0016020 membrane Cellular Component GO:0004672 protein kinase activity Molecular Function GO:0004674 protein serine/threonine kinase activity Molecular Function GO:0005516 calmodulin binding Molecular Function GO:0005524 ATP binding Molecular Function |
| KEGG gene cross-reference | ath:AT1G34300 ath:AT4G00340 ath:AT5G24080 zma:542378 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF08432Vfa113-33 aaPF10500SR-2525-27 aaPF04145Ctr35-66 aaPF09073BUD22128-275 aaPF17846XRN_M155-276 aaPF04145Ctr157-243 aaPF02862DDHD164-255 aaPF04546Sigma70_ner177-268 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G396230 | PF08432 | Vfa1 | 13 | 33 | 7.5 | 7.6 |
| TkA07G396230 | PF10500 | SR-25 | 25 | 27 | 0.0018 | 18.6 |
| TkA07G396230 | PF04145 | Ctr | 35 | 66 | 0.91 | 10.8 |
| TkA07G396230 | PF09073 | BUD22 | 128 | 275 | 4.4e-05 | 23.7 |
| TkA07G396230 | PF17846 | XRN_M | 155 | 276 | 1.6 | 8.4 |
| TkA07G396230 | PF04145 | Ctr | 157 | 243 | 0.91 | 10.8 |
| TkA07G396230 | PF02862 | DDHD | 164 | 255 | 0.022 | 15.6 |
| TkA07G396230 | PF04546 | Sigma70_ner | 177 | 268 | 0.38 | 11.4 |
| TkA07G396230 | PF04931 | DNA_pol_phi | 179 | 276 | 0.083 | 11.8 |
| TkA07G396230 | PF08432 | Vfa1 | 183 | 267 | 7.5 | 7.6 |
| TkA07G396230 | PF04147 | Nop14 | 184 | 265 | 0.073 | 12.0 |
| TkA07G396230 | PF12722 | Hid1 | 184 | 267 | 6.3 | 5.6 |
| TkA07G396230 | PF04889 | Cwf_Cwc_15 | 185 | 262 | 2.0 | 8.9 |
| TkA07G396230 | PF06025 | DUF913 | 185 | 246 | 5.7 | 6.6 |
| TkA07G396230 | PF21119 | RYDR_Jsol | 185 | 270 | 7.4 | 6.0 |
| TkA07G396230 | PF07133 | Merozoite_SPAM | 187 | 281 | 0.015 | 16.0 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.