Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2396 bp · TkA07G386750|TK1151|cDNA
CTAATCTGGGCTCTCTCTGCATCAGACGCCGTCTCTTCTCTCTCTCTCTCGGCGAGAAACATGCACGGAAGACCGAGGAAATCTGCAACACCAGTAGACGAACATGCATCAGCTCTCAAGGCTGCAAAGATTCGATCCCTTCAAACTGAATTTCTCCAAAATCATCACAACAACATCTACACTAAAGAAGCCCTAGAAATCAATGCCAAACTTCTCGAGATTATTCCGGAGTTCATGACCGCTTGGAATTATCGAAAGCT...
2037 bp · TkA07G386750|TK1151|CDS
ATGCACGGAAGACCGAGGAAATCTGCAACACCAGTAGACGAACATGCATCAGCTCTCAAGGCTGCAAAGATTCGATCCCTTCAAACTGAATTTCTCCAAAATCATCACAACAACATCTACACTAAAGAAGCCCTAGAAATCAATGCCAAACTTCTCGAGATTATTCCGGAGTTCATGACCGCTTGGAATTATCGAAAGCTAGCGTTTGAGCATAATATCAGTAGCCAATCGGAGGCCGAAAAGGCAGATTCAGATCACCT...
Protein
Download Protein FASTA678 aa · TkA07G386750|TK1151|PROTEIN
MHGRPRKSATPVDEHASALKAAKIRSLQTEFLQNHHNNIYTKEALEINAKLLEIIPEFMTAWNYRKLAFEHNISSQSEAEKADSDHLKSIIDEELRVVENALRKNFKSYGAWHHRVWVVSKGNSSTERELKLLNMFQKQDTRNFHAWNYRRFIAGLKNISDENELQFTTDMINDNFSNYSAWHNRSVLLTQLLEKKAEGFFPKEKFLTEEYEFVRNAVFTDPDDQSGWFYHLWLLDQTVKVDMPVMVSSWPPCGSEINLP...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G386750 |
|---|---|
| TK1151 ID | TkA07G386750 |
| OH-1004 ID | LXL04_030202 |
| Relationship / confidence | Rbh Sequence Supported / Probable |
| Protein identity (%) | 92.600 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G386750 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr07:96936964-96940032 (+) | |||||||||
| Description | Similar to RGTA1: Geranylgeranyl transferase type-2 subunit alpha 1 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006888 endoplasmic reticulum to Golgi vesicle-mediated transport Biological Process GO:0018344 protein geranylgeranylation Biological Process GO:0036211 protein modification process Biological Process GO:0005576 extracellular region Cellular Component GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0005968 Rab-protein geranylgeranyltransferase complex Cellular Component GO:0004663 Rab geranylgeranyltransferase activity Molecular Function GO:0008270 zinc ion binding Molecular Function GO:0031267 small GTPase binding Molecular Function | |||||||||
| KEGG gene cross-reference | ath:AT4G24490 ath:AT5G41820 hsa:5875 pon:100174130 ssc:100049679 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF01239PPTA42-71 aaPF07021MetW63-154 aaPF24048LRR_NXF1-572-108 aaPF01239PPTA92-121 aaPF01239PPTA127-153 aaPF01239PPTA162-192 aaPF01239PPTA208-237 aaPF24048LRR_NXF1-5310-345 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G386750 | PF01239 | PPTA | 42 | 71 | 3e-38 | 127.7 |
| TkA07G386750 | PF07021 | MetW | 63 | 154 | 0.024 | 15.0 |
| TkA07G386750 | PF24048 | LRR_NXF1-5 | 72 | 108 | 0.0033 | 17.8 |
| TkA07G386750 | PF01239 | PPTA | 92 | 121 | 3e-38 | 127.7 |
| TkA07G386750 | PF01239 | PPTA | 127 | 153 | 3e-38 | 127.7 |
| TkA07G386750 | PF01239 | PPTA | 162 | 192 | 3e-38 | 127.7 |
| TkA07G386750 | PF01239 | PPTA | 208 | 237 | 3e-38 | 127.7 |
| TkA07G386750 | PF24048 | LRR_NXF1-5 | 310 | 345 | 0.0033 | 17.8 |
| TkA07G386750 | PF24048 | LRR_NXF1-5 | 426 | 469 | 0.0033 | 17.8 |
| TkA07G386750 | PF01239 | PPTA | 456 | 470 | 3e-38 | 127.7 |
| TkA07G386750 | PF13855 | LRR_8 | 515 | 567 | 4.4e-06 | 27.1 |
| TkA07G386750 | PF12799 | LRR_4 | 516 | 524 | 6.6e-07 | 30.1 |
| TkA07G386750 | PF00560 | LRR_1 | 516 | 526 | 0.0016 | 18.9 |
| TkA07G386750 | PF14580 | LRR_9 | 528 | 602 | 0.00077 | 19.8 |
| TkA07G386750 | PF13516 | LRR_6 | 534 | 547 | 0.0068 | 17.1 |
| TkA07G386750 | PF12799 | LRR_4 | 536 | 574 | 6.6e-07 | 30.1 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.