TkA07G384350 | RubberDandelionOmics

Gene overview

TkA07G384350

Reference: TK1151 Chr: Chr07 Coordinates: 96401531-96404051 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1943 bp · TkA07G384350|TK1151|cDNA

TAAGTCAATAAGTTAAACCACAGAAACACACTCACATGCCTTCCTTCGCTACTTGAGAGAGATAATTCCTTCCTGCCGTCAGCCCCCGCATAATGGAATCAATGGTGTTCACTTCTTCACTTCTTCCTTCCTCCAACCACGCCACTCTCCCTATCAGAAACCCTAGTCTATTAACATCAATTGATCACCGTCTAATCTTCTCTGTCTCCTTCGACCGTCTAGCCACGTCTCTAAACAAGCGACGCTCGGCGGCGACGGAA...

CDS

Download CDS FASTA

1599 bp · TkA07G384350|TK1151|CDS

ATGGAATCAATGGTGTTCACTTCTTCACTTCTTCCTTCCTCCAACCACGCCACTCTCCCTATCAGAAACCCTAGTCTATTAACATCAATTGATCACCGTCTAATCTTCTCTGTCTCCTTCGACCGTCTAGCCACGTCTCTAAACAAGCGACGCTCGGCGGCGACGGAAGTACTGTGCTGCGTATCACAACCAAAGAACATGGCAGCTCCACCAAAAGAAGCGAAGCTATGGGGAGGAAGGTTCGAGGAAGGAGTTACGGA...

Protein

Download Protein FASTA

532 aa · TkA07G384350|TK1151|PROTEIN

MESMVFTSSLLPSSNHATLPIRNPSLLTSIDHRLIFSVSFDRLATSLNKRRSAATEVLCCVSQPKNMAAPPKEAKLWGGRFEEGVTDAVERFTESISFDKALYKQDIMGSRAHASMLAKQGLMSFSDRDSILEGLNQIEERIERGEFEWRTDREDVHMNIEAALTDLIGEPAKKLHTARSRNDQVSTDFRLWCRDAIDTIVANIKQLQIAMVTLAKNNKGVIVPGYTHLQRAQPVLLQHHLLAYVEQLDRDAGRLLDCRV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G384350`
TK1151 ID	TkA07G384350
OH-1004 ID	LXL04_030180
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G384350

Location Chr07:96401531-96404051 (+)

Description Similar to At5g10920: Argininosuccinate lyase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g10920`	Argininosuccinate lyase, chloroplastic.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030180 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0042450 L-arginine biosynthetic process via ornithine Biological Process

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0004056 argininosuccinate lyase activity Molecular Function

KEGG gene cross-reference

aby:ABAYE3511

ath:AT5G10920

dps:DP0435

mlo:mlr3506

nis:NIS_0657

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.916

Rank 1 · TkA07G384350 · TK1151

Cytoplasm0.123

Rank 2 · TkA07G384350 · TK1151

Mitochondrion0.097

Rank 3 · TkA07G384350 · TK1151

Peroxisome0.070

Rank 4 · TkA07G384350 · TK1151

Nucleus0.033

Rank 5 · TkA07G384350 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00206Lyase_179-373 aa

PF14698ASL_C2437-504 aa

PF00206Lyase_1454-473 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G384350	`PF00206`	Lyase_1	79	373	1.2e-73	249.0
TkA07G384350	`PF14698`	ASL_C2	437	504	1.9e-25	89.8
TkA07G384350	`PF00206`	Lyase_1	454	473	1.2e-73	249.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9LEU8`	Arabidopsis thaliana	sp\|Q9LEU8\|ARLY_ARATH Argininosuccinate lyase, chloroplastic	73.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card