TkA07G383750 | RubberDandelionOmics

Gene overview

TkA07G383750

Reference: TK1151 Chr: Chr07 Coordinates: 96250378-96254885 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2951 bp · TkA07G383750|TK1151|cDNA

AAATGAGTAAAAAACTTTCAAAACAAGCGTGCGATTTGCATGTACTCAAAACACACACACAAATACAGGGCTCTCTTTGCACGCGCTGAGGGGTTATTGATGTCAATTCCTTCGTCTATTTATCATCTCTCTTCCGTGCTCTCTCCCTCTCTCTCCACCTTTCTCTTTTTTTCTCTCTCCCGCTGTTCTTCCCGTGCTCTGCCTTTTTTAATCTCACCGTCTGCCTTCTTTCCGGGTTTTCAGATTACCAGATTTCTCAT...

CDS

Download CDS FASTA

1110 bp · TkA07G383750|TK1151|CDS

ATGGTGTGTCAATCAGCGGGACAAACAAGATTTCGGGCTTTGAAACACGAAACTGGAACCGCTGGGAGCGCCACCATAGTTGTTAAAGTTATAGCATGTTTTCAACCTCTCGATGATTGTCAGGCCGAATACTTCCGCCATTTGTTAAAACCTAAGTTTTCAGAAATCTTTACACATTCAAAAGTCATCGTTCATCACCCGGTAATTTTCCACCGAATGGAAAGGGGTTTTGAATCTTGGTTTCAAAACCAAAAAATCGA...

Protein

Download Protein FASTA

369 aa · TkA07G383750|TK1151|PROTEIN

MVCQSAGQTRFRALKHETGTAGSATIVVKVIACFQPLDDCQAEYFRHLLKPKFSEIFTHSKVIVHHPVIFHRMERGFESWFQNQKIDWQSPNPNTPSSRTQGTIPCYGNTVPTVRQEPCGWFYGLPRHRQGVSVTPVVNKQQLQVTSPNAGQKKFLVFDQSGDQTTLIYSSGVGPNPIRYQFPLSNNPQKPQSGSYPVRINENIIENDSKSEMREDSEELNALLYSDDEENDYSENEETSTGHSPNSMMFLEKKGQNGNE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G383750`
TK1151 ID	TkA07G383750
OH-1004 ID	LXL04_030170
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G383750

Location Chr07:96250378-96254885 (-)

Description Similar to BHLH145: Transcription factor bHLH145

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g50010`	Transcription factor bHLH145.	No verified direct reference in this release
`At5g09460`	Transcription factor bHLH143.	No verified direct reference in this release
`At5g64340`	Transcription factor.	The dwarf phenotype of the Arabidopsis acl5 mutant is suppressed by a mutation in an upstream ORF of a bHLH gene.2006 · DOI: 10.1242/dev.02535

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_030170 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0009826 unidimensional cell growth Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0003677 DNA binding Molecular Function

GO:0003700 DNA-binding transcription factor activity Molecular Function

GO:0046983 protein dimerization activity Molecular Function

KEGG gene cross-reference

ath:AT5G09460

ath:AT5G50010

ath:AT5G64340

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.973

Rank 1 · TkA07G383750 · TK1151

Cytoplasm0.087

Rank 2 · TkA07G383750 · TK1151

Cell membrane0.025

Rank 3 · TkA07G383750 · TK1151

Endoplasmic reticulum0.016

Rank 4 · TkA07G383750 · TK1151

Plastid0.011

Rank 5 · TkA07G383750 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23173bHLH_SAC51315-361 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G383750	`PF23173`	bHLH_SAC51	315	361	3.6e-11	43.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FGB0`	Arabidopsis thaliana	sp\|Q9FGB0\|BH145_ARATH Transcription factor bHLH145	31.600%	Swiss-Prot	Medium
`Q9FY69`	Arabidopsis thaliana	sp\|Q9FY69\|BH143_ARATH Transcription factor bHLH143	30.800%	Swiss-Prot	Medium
`Q9FMF4`	Arabidopsis thaliana	sp\|Q9FMF4\|SAC51_ARATH Transcription factor SAC51	30.300%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card