TkA07G382290 | RubberDandelionOmics

Gene overview

TkA07G382290

Reference: TK1151 Chr: Chr07 Coordinates: 95833570-95835782 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1580 bp · TkA07G382290|TK1151|cDNA

TTTTCTCTCTCCTTCTAGGGTCTACTTACAACATCACGTGTAAACATACTGTAGAATCTTTTGTTTCATTTATGGTTCATCTTTATAAGAACAAAAAATAGATGCACACTCTTAAGCCATTGTTGTCTACCATCAAGATTCAAGAGATTAAAAAGGCTTCTTTGTTTTGATCTTTGGAGTATTCTTCTTCTTGGTCTTATGCTCCAAACTTTAAATCTTTAGACGTCTTCTTCAATACCAACCTTAATCCATAGTCGAGT...

CDS

Download CDS FASTA

861 bp · TkA07G382290|TK1151|CDS

ATGAATACTGGGAGATTACTCTTCATCTTCTTCAGCGATGTTATTATGGATCAATGCGATCCTAAATCTTCACCGGAAGATTGTACCGGCGGTGGCCAGTGCGACAGGTTTTTTCTTGGGGAACAGAAGGTGGAATCATCACCAACTGCCACCATCCCAACCACCATATCCACGGCGGCAGCTCGGAGAAAGCGGAGGCGCACAAAGAGTGGGAAGAATAAAGAGGACTTAGAGAATCAACGGATGACTCATATTACGGT...

Protein

Download Protein FASTA

286 aa · TkA07G382290|TK1151|PROTEIN

MNTGRLLFIFFSDVIMDQCDPKSSPEDCTGGGQCDRFFLGEQKVESSPTATIPTTISTAAARRKRRRTKSGKNKEDLENQRMTHITVERNRRKQMNEYLAVIRSMMPSSYVQRGDQASIVAGAINFVKELEHQLQILEVKKRSNINGYSSPPPPPPQPFGEFFTFPQYSISRGNDDGGGGSGGSATMTKNRPPAMAEIEVTMVESHANLKILSKKRQRQLLKMVAGLQCLWFTILHLNVTTVDQQMVLYTLSVKLEDGCQ...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G382290`
TK1151 ID	TkA07G382290
OH-1004 ID	LXL04_026135
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	53.500
Protein coverage (%)	TK1151 74.825 / OH-1004 60.907 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G382290

Location Chr07:95833570-95835782 (-)

Description Similar to BHLH96: Transcription factor bHLH96

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g22490`	Transcription factor bHLH94.	No verified direct reference in this release
`At1g72210`	Transcription factor bHLH96.	No verified direct reference in this release
`At5g46690`	Transcription factor.	No verified direct reference in this release
`At5g65320`	Transcription factor bHLH99.	No verified direct reference in this release
`At3g61950`	Transcription factor bHLH67.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026135 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0010052 guard cell differentiation Biological Process

GO:0010374 stomatal complex development Biological Process

GO:0010377 guard cell fate commitment Biological Process

GO:0010444 guard mother cell differentiation Biological Process

GO:0045597 positive regulation of cell differentiation Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0051782 negative regulation of cell division Biological Process

GO:0090547 response to low humidity Biological Process

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT1G22490

ath:AT1G72210

ath:AT3G24140

ath:AT4G01460

ath:AT5G46690

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.959

Rank 1 · TkA07G382290 · TK1151

Cytoplasm0.100

Rank 2 · TkA07G382290 · TK1151

Cell membrane0.032

Rank 3 · TkA07G382290 · TK1151

Endoplasmic reticulum0.022

Rank 4 · TkA07G382290 · TK1151

Plastid0.013

Rank 5 · TkA07G382290 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03369Herpes_UL351-130 aa

PF00010HLH59-68 aa

PF00010HLH80-131 aa

PF23177bHLH_IRO386-138 aa

PF22754bHLH-TF_ACT-like_plant197-268 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G382290	`PF03369`	Herpes_UL3	51	130	0.18	13.1
TkA07G382290	`PF00010`	HLH	59	68	1.2e-10	41.7
TkA07G382290	`PF00010`	HLH	80	131	1.2e-10	41.7
TkA07G382290	`PF23177`	bHLH_IRO3	86	138	0.0024	18.9
TkA07G382290	`PF22754`	bHLH-TF_ACT-like_plant	197	268	0.012	16.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SK91`	Arabidopsis thaliana	sp\|Q9SK91\|BH094_ARATH Transcription factor bHLH94	55.600%	Swiss-Prot	High
`Q9C7T4`	Arabidopsis thaliana	sp\|Q9C7T4\|BH096_ARATH Transcription factor bHLH96	57.100%	Swiss-Prot	High
`Q56XR0`	Arabidopsis thaliana	sp\|Q56XR0\|BH071_ARATH Transcription factor bHLH71	43.700%	Swiss-Prot	Medium
`Q9FKQ6`	Arabidopsis thaliana	sp\|Q9FKQ6\|BH099_ARATH Transcription factor bHLH99	47.100%	Swiss-Prot	Medium
`Q700E4`	Arabidopsis thaliana	sp\|Q700E4\|BH067_ARATH Transcription factor bHLH67	42.200%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card