TkA07G379990 | RubberDandelionOmics

Gene overview

TkA07G379990

Reference: TK1151 Chr: Chr07 Coordinates: 95187105-95195862 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2628 bp · TkA07G379990|TK1151|cDNA

ATGGAGTTTAAACTGGAAACTGGCAAACGGACCGCCATTTCTAAATCTGCTTTCACCAAACTGTTGAAACTTTCACTGGATTCAAACCTCATTGACCCAGACACCATATCCAGCTCGGATATTATCATGACCTTTAACCAGATGGGGCATACTCCAATTCTCACCCGTCTCTCTGCATTCAAAAAGAATAAACTCCCGTCTATTTGGAGTTGCTTGTTTACGATTCTGTTCAAATGTCTAGCTGAACGTCAAACTGGAAC...

CDS

Download CDS FASTA

2628 bp · TkA07G379990|TK1151|CDS

ATGGAGTTTAAACTGGAAACTGGCAAACGGACCGCCATTTCTAAATCTGCTTTCACCAAACTGTTGAAACTTTCACTGGATTCAAACCTCATTGACCCAGACACCATATCCAGCTCGGATATTATCATGACCTTTAACCAGATGGGGCATACTCCAATTCTCACCCGTCTCTCTGCATTCAAAAAGAATAAACTCCCGTCTATTTGGAGTTGCTTGTTTACGATTCTGTTCAAATGTCTAGCTGAACGTCAAACTGGAAC...

Protein

Download Protein FASTA

875 aa · TkA07G379990|TK1151|PROTEIN

MEFKLETGKRTAISKSAFTKLLKLSLDSNLIDPDTISSSDIIMTFNQMGHTPILTRLSAFKKNKLPSIWSCLFTILFKCLAERQTGTDSADIAKILWTQFCESPTSASKDTEISMARFWSLVVDYAHRHYNIEQTVPLTDETIAKFPEMQIAKLTLKSDNSCEFVGKIPEEMLDKIDKENALLKAYKLANPLPYLLREIPDDVLVLIEKQKVVPRQQGKRKKGMNNPITSIPITPTIPISTSITTTQPQSTQIPVTKSPP...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G379990`
TK1151 ID	TkA07G379990
OH-1004 ID	LXL04_023715
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	60.300
Protein coverage (%)	TK1151 95.086 / OH-1004 99.269 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G379990`
Location	Chr07:95187105-95195862 (-)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_023715` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	No functional description available
KEGG gene cross-reference	No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.816

Rank 1 · TkA07G379990 · TK1151

Cytoplasm0.244

Rank 2 · TkA07G379990 · TK1151

Mitochondrion0.035

Rank 3 · TkA07G379990 · TK1151

Cell membrane0.022

Rank 4 · TkA07G379990 · TK1151

Endoplasmic reticulum0.012

Rank 5 · TkA07G379990 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF07739TipAS335-384 aa

PF27400TP_0700344-392 aa

PF01145Band_7365-469 aa

PF22456PqqF-like_C_4376-422 aa

PF27400TP_0700431-476 aa

PF07739TipAS434-480 aa

PF07739TipAS736-775 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G379990	`PF07739`	TipAS	335	384	0.34	12.2
TkA07G379990	`PF27400`	TP_0700	344	392	7.7	7.2
TkA07G379990	`PF01145`	Band_7	365	469	0.021	15.5
TkA07G379990	`PF22456`	PqqF-like_C_4	376	422	0.44	11.4
TkA07G379990	`PF27400`	TP_0700	431	476	7.7	7.2
TkA07G379990	`PF07739`	TipAS	434	480	0.34	12.2
TkA07G379990	`PF07739`	TipAS	736	775	0.34	12.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card