TkA07G379060 | RubberDandelionOmics

Gene overview

TkA07G379060

Reference: TK1151 Chr: Chr07 Coordinates: 94993389-94996479 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1712 bp · TkA07G379060|TK1151|cDNA

TTTGTTCTTTCCAAAGAGAACCCCGAATACCTTCTCAACTGTACATCTCTACTCTCCGTCTTGGCTCTTGCCCACAAATCATCCCTCTATCCAAACAATGCTCCACTGAACAAGGGTTCATCCATGGCTCTTCTTCCCGTGGTCCGCCATTTTCTCACACACTTACACCATCCCACTTCAAAACCCACCTCCTCCTCCACAGCTATAGCCATAATTCGTACGTTTAAAACCCTATCACCGTTTTCCTCTCTTCTTCTCCC...

CDS

Download CDS FASTA

642 bp · TkA07G379060|TK1151|CDS

ATGTCACATGATGTTGAAAATGCAATGGAAACCGCTAATTATGACAAATTTTTGCAATCCGGATTACAGATTGCGATTATTGGTCGACCAAATGTGGGGAAATCTAGTCTGCTAAATTCATGGAGTAAGAGTGAAAGGGCAATAGTTACAGACATTGCGGGAACTACACGAGATGTTGTGGAAGCCAATGTAACGGTTCATGGAATCCCAGTCACACTACTCGATACAGCTGGCATTAGAGAAACCGATGATATTGTTGA...

Protein

Download Protein FASTA

213 aa · TkA07G379060|TK1151|PROTEIN

MSHDVENAMETANYDKFLQSGLQIAIIGRPNVGKSSLLNSWSKSERAIVTDIAGTTRDVVEANVTVHGIPVTLLDTAGIRETDDIVEKIGVERSEAVALGADVVIMAVSAVDGWTTEDAKLLDKIKHTKVMGASGSPVILAINKIDCAPSACSELVNAMVKLLISVYIHVLSQVKGFQIWRVQFLSLWASITFLQVKWKKVGREPGLDNVLSG

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G379060`
TK1151 ID	TkA07G379060
OH-1004 ID	LXL04_030081
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	96.900
Protein coverage (%)	TK1151 74.648 / OH-1004 28.086 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G379060`
Location	Chr07:94993389-94996479 (-)
Description	Similar to mnmE: tRNA modification GTPase MnmE (Trichodesmium erythraeum (strain IMS101)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_030081` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0002098 tRNA wobble uridine modification Biological Process GO:0030488 tRNA methylation Biological Process GO:0005829 cytosol Cellular Component GO:0003924 GTPase activity Molecular Function GO:0005525 GTP binding Molecular Function GO:0042802 identical protein binding Molecular Function GO:0046872 metal ion binding Molecular Function
KEGG gene cross-reference	ana:all4677 ava:Ava_1989 syc:syc0039_c syf:Synpcc7942_1582 ter:Tery_4774 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.444

Rank 1 · TkA07G379060 · TK1151

Mitochondrion0.282

Rank 2 · TkA07G379060 · TK1151

Nucleus0.213

Rank 3 · TkA07G379060 · TK1151

Peroxisome0.114

Rank 4 · TkA07G379060 · TK1151

Plastid0.062

Rank 5 · TkA07G379060 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF03193RsgA_GTPase8-82 aa

PF01926MMR_HSR123-144 aa

PF02421FeoB_N23-163 aa

PF04548AIG123-129 aa

PF05621TniB23-62 aa

PF00071Ras24-148 aa

PF08477Roc24-146 aa

PF00350Dynamin_N24-60 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G379060	`PF03193`	RsgA_GTPase	8	82	0.00049	20.7
TkA07G379060	`PF01926`	MMR_HSR1	23	144	4.4e-25	88.7
TkA07G379060	`PF02421`	FeoB_N	23	163	1.7e-09	38.1
TkA07G379060	`PF04548`	AIG1	23	129	2.7e-05	24.3
TkA07G379060	`PF05621`	TniB	23	62	0.25	11.5
TkA07G379060	`PF00071`	Ras	24	148	0.00011	22.5
TkA07G379060	`PF08477`	Roc	24	146	0.00041	21.3
TkA07G379060	`PF00350`	Dynamin_N	24	60	0.0057	17.4
TkA07G379060	`PF13191`	AAA_16	24	165	0.028	15.7
TkA07G379060	`PF22079`	HopBA1	30	73	0.08	13.4
TkA07G379060	`PF00009`	GTP_EFTU	54	167	1.8e-06	28.4
TkA07G379060	`PF00350`	Dynamin_N	70	123	0.0057	17.4
TkA07G379060	`PF03193`	RsgA_GTPase	119	152	0.00049	20.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card