TkA07G355520 | RubberDandelionOmics

Gene overview

TkA07G355520

Reference: TK1151 Chr: Chr07 Coordinates: 88987463-88992140 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3396 bp · TkA07G355520|TK1151|cDNA

ATGCATGCATCGAGCAGGGTGCGGGTCGCGGTTTTCTCTGGGTCGTTTTTCGCGAAAGAGAAAAAGAAACGCGAAAAAATGTTGCCGTATATTCCCATCATCGCAGCTCTTGAAGCCTTTGACCTCGATGAGTTTGTTCTCAATCCAAATCCACCCACCACCACCATTGAAGTTCCAGCCACCGAAGGAACGCCTGCCACTGCCACTTATCCTGCTGTTCCTGCAACTCCGGCTTCCATAGCACCAAATCCGGCTTTTGT...

CDS

Download CDS FASTA

3396 bp · TkA07G355520|TK1151|CDS

ATGCATGCATCGAGCAGGGTGCGGGTCGCGGTTTTCTCTGGGTCGTTTTTCGCGAAAGAGAAAAAGAAACGCGAAAAAATGTTGCCGTATATTCCCATCATCGCAGCTCTTGAAGCCTTTGACCTCGATGAGTTTGTTCTCAATCCAAATCCACCCACCACCACCATTGAAGTTCCAGCCACCGAAGGAACGCCTGCCACTGCCACTTATCCTGCTGTTCCTGCAACTCCGGCTTCCATAGCACCAAATCCGGCTTTTGT...

Protein

Download Protein FASTA

1131 aa · TkA07G355520|TK1151|PROTEIN

MHASSRVRVAVFSGSFFAKEKKKREKMLPYIPIIAALEAFDLDEFVLNPNPPTTTIEVPATEGTPATATYPAVPATPASIAPNPAFVTWKKRDRFVLLWLQSTLSERALAIVTRCTSSHMAWQAIEKTFQAQSRANRMQLKAQLQSLSKGSMSMIEYIQRKRSIADSLAENLHPVPDEDLIGHLLSGLDSSYGAFITAFMMKTEAFSIDDLAGLLLQEEARIEQKHLRQASIQPTSASITVNRPSTRSPASFPEQNSGPS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G355520`
TK1151 ID	TkA07G355520
OH-1004 ID	LXL04_019813
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	54.800
Protein coverage (%)	TK1151 97.082 / OH-1004 67.773 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G355520

Location Chr07:88987463-88992140 (+)

Description Similar to BMY1: Beta-amylase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`UniProt: Q94HW2`	Retrovirus-related Pol polyprotein from transposon RE1.	No verified direct reference in this release
`At4g02960`	Retrovirus-related Pol polyprotein from transposon RE2.	No verified direct reference in this release
`UniProt: P92519`	Uncharacterized mitochondrial protein AtMg00810.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_019813 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000272 polysaccharide catabolic process Biological Process

GO:0005983 starch catabolic process Biological Process

GO:0080027 response to herbivore Biological Process

GO:0005576 extracellular region Cellular Component

GO:0099503 secretory vesicle Cellular Component

GO:0016161 beta-amylase activity Molecular Function

KEGG gene cross-reference

ath:AT4G15210

gmx:547931

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.620

Rank 1 · TkA07G355520 · TK1151

Nucleus0.437

Rank 2 · TkA07G355520 · TK1151

Mitochondrion0.094

Rank 3 · TkA07G355520 · TK1151

Peroxisome0.048

Rank 4 · TkA07G355520 · TK1151

Plastid0.044

Rank 5 · TkA07G355520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14223Retrotran_gag_273-225 aa

PF19960EAD7153-164 aa

PF19960EAD7204-217 aa

PF22936Pol_BBD293-367 aa

PF13976gag_pre-integrs397-463 aa

PF07727RVT_2670-718 aa

PF07727RVT_2717-885 aa

PF19960EAD7825-863 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G355520	`PF14223`	Retrotran_gag_2	73	225	7.3e-20	72.1
TkA07G355520	`PF19960`	EAD7	153	164	0.42	11.3
TkA07G355520	`PF19960`	EAD7	204	217	0.42	11.3
TkA07G355520	`PF22936`	Pol_BBD	293	367	4.1e-08	34.1
TkA07G355520	`PF13976`	gag_pre-integrs	397	463	1.7e-13	50.8
TkA07G355520	`PF07727`	RVT_2	670	718	1.6e-56	192.3
TkA07G355520	`PF07727`	RVT_2	717	885	1.6e-56	192.3
TkA07G355520	`PF19960`	EAD7	825	863	0.42	11.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94HW2`	Arabidopsis thaliana	sp\|Q94HW2\|POLR1_ARATH Retrovirus-related Pol polyprotein from transposon RE1	50.600%	Swiss-Prot	Low
`Q9ZT94`	Arabidopsis thaliana	sp\|Q9ZT94\|POLR2_ARATH Retrovirus-related Pol polyprotein from transposon RE2	49.000%	Swiss-Prot	Low
`P92519`	Arabidopsis thaliana	sp\|P92519\|M810_ARATH Uncharacterized mitochondrial protein AtMg00810	42.700%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card