TkA07G353020 | RubberDandelionOmics

Gene overview

TkA07G353020

Reference: TK1151 Chr: Chr07 Coordinates: 88251725-88253082 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

624 bp · TkA07G353020|TK1151|cDNA

ATGGAAACCGGAGGAGAAATCCTTAACTTGGACGAGTACATAAGGTCTTTTCCTCCAATCCTTGGCACAAAACCACTTGGATTCGTTTCAGAGGGGTCGAGAGCTACTAGCGTGGTGTCTCTCGGAAACGCAGACCTCGTGCAGGCCTTGCTCGATGCAAATCGATGGAGAGATATGTTTTCAAGCATGATCGGAAGCAGTGCTACAACGGAAGTTATTCTCGATAGCGGCATAAACAATGTCCTCCAACTTATGCAAAC...

CDS

Download CDS FASTA

624 bp · TkA07G353020|TK1151|CDS

ATGGAAACCGGAGGAGAAATCCTTAACTTGGACGAGTACATAAGGTCTTTTCCTCCAATCCTTGGCACAAAACCACTTGGATTCGTTTCAGAGGGGTCGAGAGCTACTAGCGTGGTGTCTCTCGGAAACGCAGACCTCGTGCAGGCCTTGCTCGATGCAAATCGATGGAGAGATATGTTTTCAAGCATGATCGGAAGCAGTGCTACAACGGAAGTTATTCTCGATAGCGGCATAAACAATGTCCTCCAACTTATGCAAAC...

Protein

Download Protein FASTA

207 aa · TkA07G353020|TK1151|PROTEIN

METGGEILNLDEYIRSFPPILGTKPLGFVSEGSRATSVVSLGNADLVQALLDANRWRDMFSSMIGSSATTEVILDSGINNVLQLMQTEIQLISPSVPARVMKFFQFSRQQAEGVWAVLDLSFDIDDNGGMCRRLPSGCILYQLFFIAFQVFDKIPRRTMIKCVFAETCERVMLPRLDYKRKRRVISLGMCDPTTFPCFTIVSNSSCR

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G353020`
TK1151 ID	TkA07G353020
OH-1004 ID	LXL04_008598
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	89.900
Protein coverage (%)	TK1151 70.531 / OH-1004 74.129 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G353020

Location Chr07:88251725-88253082 (+)

Description Similar to HDG1: Homeobox-leucine zipper protein HDG1

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g00730`	Probable transcription factor involved in the regulation of the tissue-specific accumulation of anthocyanins and in cellular organization of the primary root.	ANTHOCYANINLESS2, a homeobox gene affecting anthocyanin distribution and root development in Arabidopsis.1999 · DOI: 10.1105/tpc.11.7.1217
`At4g21750`	Probable transcription factor involved in cell specification and pattern formation during embryogenesis.	Identification of a cis-regulatory element for L1 layer-specific gene expression, which is targeted by an L1-specific homeodomain protein.2001 · DOI: 10.1046/j.1365-313x.2001.01047.x Regulation of shoot epidermal cell differentiation by a pair of homeodomain proteins in Arabidopsis.2003 · DOI: 10.1242/dev.00292 Arabidopsis DELLA and two HD-ZIP transcription factors regulate GA signaling in the epidermis through the L1 box cis-element.2014 · DOI: 10.1105/tpc.114.127647
`At4g04890`	Probable transcription factor that binds to the L1 box DNA sequence 5'-TAAATG[CT]A-3'.	Regulation of shoot epidermal cell differentiation by a pair of homeodomain proteins in Arabidopsis.2003 · DOI: 10.1242/dev.00292 Mutations in epidermis-specific HD-ZIP IV genes affect floral organ identity in Arabidopsis thaliana.2013 · DOI: 10.1111/tpj.12211 Arabidopsis DELLA and two HD-ZIP transcription factors regulate GA signaling in the epidermis through the L1 box cis-element.2014 · DOI: 10.1105/tpc.114.127647

Rice

Reference gene ID	Possible function	Papers / DOI
`Os04g0569100`	Probable transcription factor.	No verified direct reference in this release
`Os09g0526300`	Probable transcription factor.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_008598 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0009827 plant-type cell wall modification Biological Process

GO:0010090 trichome morphogenesis Biological Process

GO:0010143 cutin biosynthetic process Biological Process

GO:0010214 seed coat development Biological Process

GO:0030154 cell differentiation Biological Process

GO:0043481 anthocyanin accumulation in tissues in response to UV light Biological Process

GO:0048354 mucilage biosynthetic process involved in seed coat development Biological Process

GO:0048364 root development Biological Process

GO:0048497 maintenance of floral organ identity Biological Process

GO:0048765 root hair cell differentiation Biological Process

GO:0052541 plant-type cell wall cellulose metabolic process Biological Process

KEGG gene cross-reference

ath:AT1G05230

ath:AT3G61150

ath:AT4G00730

dosa:Os02g0674800

dosa:Os04g0569100

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.360

Rank 1 · TkA07G353020 · TK1151

Cytoplasm0.346

Rank 2 · TkA07G353020 · TK1151

Endoplasmic reticulum0.121

Rank 3 · TkA07G353020 · TK1151

Cell membrane0.113

Rank 4 · TkA07G353020 · TK1151

Plastid0.109

Rank 5 · TkA07G353020 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF01852START10-140 aa

PF06141Phage_tail_U35-124 aa

PF15002ERK-JNK_inhib44-92 aa

PF18517LZ3wCH52-64 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G353020	`PF01852`	START	10	140	7.8e-10	39.2
TkA07G353020	`PF06141`	Phage_tail_U	35	124	0.013	16.4
TkA07G353020	`PF15002`	ERK-JNK_inhib	44	92	0.17	12.3
TkA07G353020	`PF18517`	LZ3wCH	52	64	0.35	11.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q0WV12`	Arabidopsis thaliana	sp\|Q0WV12\|ANL2_ARATH Homeobox-leucine zipper protein ANTHOCYANINLESS 2	45.000%	Swiss-Prot	Medium
`Q8RWU4`	Arabidopsis thaliana	sp\|Q8RWU4\|ATML1_ARATH Homeobox-leucine zipper protein MERISTEM L1	39.600%	Swiss-Prot	Medium
`Q93V99`	Arabidopsis thaliana	sp\|Q93V99\|PDF2_ARATH Homeobox-leucine zipper protein PROTODERMAL FACTOR 2	41.400%	Swiss-Prot	Medium
`Q7Y0V9`	Oryza sativa subsp. japonica	sp\|Q7Y0V9\|ROC4_ORYSJ Homeobox-leucine zipper protein ROC4	46.200%	Swiss-Prot	Medium
`Q7Y0V7`	Oryza sativa subsp. japonica	sp\|Q7Y0V7\|ROC6_ORYSJ Homeobox-leucine zipper protein ROC6	39.400%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card