TkA07G352270 | RubberDandelionOmics

Gene overview

TkA07G352270

Reference: TK1151 Chr: Chr07 Coordinates: 88063944-88065894 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1234 bp · TkA07G352270|TK1151|cDNA

CAAGTAGTTGAAATGCAACTTTCACCCCACCAGTAGTTCCTGTTGGCTTCGATTTACTCCCTCACCAAACATTCCAAGCTTCTAAATAAGTTTCCAATTATCTCTAACCCAATCTCCCCCATGCTCACATGCTCTCAGCCATAAGTTATCTCCATCACAGACCATGCTCTGATCTTTCTCCCTTTTCTTGAAAACAAACTGTAAACATCAAAACTATGTCTTCATCAATGGCTTTGTTCTCTTCAACAACACCACATCTT...

CDS

Download CDS FASTA

735 bp · TkA07G352270|TK1151|CDS

ATGTCTTCATCAATGGCTTTGTTCTCTTCAACAACACCACATCTTCCTTCTTTATCTTCTTCCTTCAAAACCCACCTTCCAGTTAACCCATTTCTCTCTTTGAAGCCTCAAAGACACCTGCTTTCCGTGTCTGTTAGAGCTACTGAAAATGGGGCCGGAACTGTCATTGTTGTGGACGAGAAGAAAGATTCTGAGCCAAAGGTGCCGGAGGAGGCCGCTCTCGGAAACGGAGCTCCGATGGCCGATGCGCCGGAGGAAGT...

Protein

Download Protein FASTA

244 aa · TkA07G352270|TK1151|PROTEIN

MSSSMALFSSTTPHLPSLSSSFKTHLPVNPFLSLKPQRHLLSVSVRATENGAGTVIVVDEKKDSEPKVPEEAALGNGAPMADAPEEVMAKFEDPKWVSGTWDLKQFQKGGATDWDDVIDAEVKRRKWLEDNPESSNNDFPVVFDTSIIPWWAWVKRFHLPEAEKLNGRAAMVGFFMAYFVDSLTGVGLVDQMGNFFCKTLLFVAVGGVLLIRKNEDFDTLKKLFDETTFYDKQWQATWQDEKKE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G352270`
TK1151 ID	TkA07G352270
OH-1004 ID	LXL04_029841
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G352270

Location Chr07:88063944-88065894 (+)

Description Similar to LIL3.1: Light-harvesting complex-like protein 3 isotype 1, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g47110`	Light-harvesting-like protein required for biosynthesis of phytylated chlorophylls and alpha-tocopherol in green seedlings.	Lil3 dimerization and chlorophyll binding in Arabidopsis thaliana.2015 · DOI: 10.1016/j.febslet.2015.08.023
`At4g17600`	Light-harvesting-like protein required for biosynthesis of phytylated chlorophylls and alpha-tocopherol in green seedlings.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029841 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0015979 photosynthesis Biological Process

GO:1902326 positive regulation of chlorophyll biosynthetic process Biological Process

GO:1904964 positive regulation of phytol biosynthetic process Biological Process

GO:1904966 positive regulation of vitamin E biosynthetic process Biological Process

GO:0005829 cytosol Cellular Component

GO:0009503 thylakoid light-harvesting complex Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009523 photosystem II Cellular Component

GO:0009535 chloroplast thylakoid membrane Cellular Component

GO:0009536 plastid Cellular Component

GO:0042651 thylakoid membrane Cellular Component

KEGG gene cross-reference

ath:AT4G17600

ath:AT5G47110

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.985

Rank 1 · TkA07G352270 · TK1151

Mitochondrion0.020

Rank 2 · TkA07G352270 · TK1151

Nucleus0.015

Rank 3 · TkA07G352270 · TK1151

Cytoplasm0.015

Rank 4 · TkA07G352270 · TK1151

Cell membrane0.012

Rank 5 · TkA07G352270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF30879LIL3_90-167 aa

PF13521AAA_28101-167 aa

PF00504Chloroa_b-bind159-188 aa

PF31213HliA162-189 aa

PF06149DUF969189-212 aa

PF30879LIL3_229-238 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G352270	`PF30879`	LIL3_	90	167	4.7e-40	136.5
TkA07G352270	`PF13521`	AAA_28	101	167	0.19	12.6
TkA07G352270	`PF00504`	Chloroa_b-bind	159	188	0.032	15.5
TkA07G352270	`PF31213`	HliA	162	189	2.8e-05	24.7
TkA07G352270	`PF06149`	DUF969	189	212	0.25	11.6
TkA07G352270	`PF30879`	LIL3_	229	238	4.7e-40	136.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6NKS4`	Arabidopsis thaliana	sp\|Q6NKS4\|LIL32_ARATH Light-harvesting complex-like protein 3 isotype 2, chloroplastic	60.200%	Swiss-Prot	High
`Q9SYX1`	Arabidopsis thaliana	sp\|Q9SYX1\|LIL31_ARATH Light-harvesting complex-like protein 3 isotype 1, chloroplastic	57.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card