TkA07G332370 | RubberDandelionOmics

Gene overview

TkA07G332370

Reference: TK1151 Chr: Chr07 Coordinates: 83096742-83098787 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1695 bp · TkA07G332370|TK1151|cDNA

ATGATGACAAACAATCGAAGTTGTCATTCAAGAAGGACCCAACCGGAGAAGGCCATGTATATACATGGAAAACATGACGAAGTCAGAATTGCAAAAGCAATTTTAGGTATCTTCACCATTGGCGAACTCCCTTTCAAGTGGCTTAAAAATGAAGCATGTATCGAGCTTGTTAACGCATTGAATGGTAGGGTGATATTGCCTTCTAGGCATACGGCTTCCCGAAATGTTGCCCAATTGTATTTAGATGAGAGAAGTAAGTT...

CDS

Download CDS FASTA

1695 bp · TkA07G332370|TK1151|CDS

ATGATGACAAACAATCGAAGTTGTCATTCAAGAAGGACCCAACCGGAGAAGGCCATGTATATACATGGAAAACATGACGAAGTCAGAATTGCAAAAGCAATTTTAGGTATCTTCACCATTGGCGAACTCCCTTTCAAGTGGCTTAAAAATGAAGCATGTATCGAGCTTGTTAACGCATTGAATGGTAGGGTGATATTGCCTTCTAGGCATACGGCTTCCCGAAATGTTGCCCAATTGTATTTAGATGAGAGAAGTAAGTT...

Protein

Download Protein FASTA

564 aa · TkA07G332370|TK1151|PROTEIN

MMTNNRSCHSRRTQPEKAMYIHGKHDEVRIAKAILGIFTIGELPFKWLKNEACIELVNALNGRVILPSRHTASRNVAQLYLDERSKLLKHLSNPNTAVHLTTDTWISPCQRKNYMVVTAHFIDDDWVMHKRVVNFREVDTHKGEDMARELLVCIHEWGMKKVMSMTVDNAKSNDVAIKYLVKKLPNVYDNENQFHIRCMAHIINLIVKMGLKHQNYHIECIQNAVKYIRGSTQRIKKFKKAMKDVAVDTKRFLCGETPTR...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G332370`
TK1151 ID	TkA07G332370
OH-1004 ID	LXL04_022993
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	90.200
Protein coverage (%)	TK1151 95.922 / OH-1004 13.476 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G332370

Location Chr07:83096742-83098787 (-)

Description Similar to Putative AC transposase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

No hit for this species in the current source table.

Rice

Reference gene ID	Possible function	Papers / DOI
`Os03g0733400`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release
`Os05g0583200`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release
`Os05g0239150`	Transposase-like protein that is essential for plant growth and development.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_022993 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006310 DNA recombination Biological Process

GO:0032196 transposition Biological Process

GO:0003677 DNA binding Molecular Function

GO:0046983 protein dimerization activity Molecular Function

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.928

Rank 1 · TkA07G332370 · TK1151

Cytoplasm0.120

Rank 2 · TkA07G332370 · TK1151

Mitochondrion0.023

Rank 3 · TkA07G332370 · TK1151

Cell membrane0.013

Rank 4 · TkA07G332370 · TK1151

Extracellular0.012

Rank 5 · TkA07G332370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04937DUF65992-212 aa

PF27041ZBED1_RNase-like101-185 aa

PF26742DUF8247112-161 aa

PF27039ZBED1_RNase-like_helical196-292 aa

PF14372hAT-like_RNase-H215-219 aa

PF27046FAM200-GTF2IRD2-like217-287 aa

PF14372hAT-like_RNase-H329-354 aa

PF05699Dimer_Tnp_hAT441-522 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G332370	`PF04937`	DUF659	92	212	1.5e-05	25.3
TkA07G332370	`PF27041`	ZBED1_RNase-like	101	185	1.3e-19	70.8
TkA07G332370	`PF26742`	DUF8247	112	161	0.023	15.4
TkA07G332370	`PF27039`	ZBED1_RNase-like_helical	196	292	8.4e-22	78.0
TkA07G332370	`PF14372`	hAT-like_RNase-H	215	219	0.11	13.5
TkA07G332370	`PF27046`	FAM200-GTF2IRD2-like	217	287	0.00065	20.3
TkA07G332370	`PF14372`	hAT-like_RNase-H	329	354	0.11	13.5
TkA07G332370	`PF05699`	Dimer_Tnp_hAT	441	522	2.9e-24	85.4
TkA07G332370	`PF27041`	ZBED1_RNase-like	521	555	1.3e-19	70.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q6AVI0`	Oryza sativa subsp. japonica	sp\|Q6AVI0\|RSLE2_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 2	25.600%	Swiss-Prot	Low
`Q75HY5`	Oryza sativa subsp. japonica	sp\|Q75HY5\|RSLE3_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 3	25.100%	Swiss-Prot	Low
`B9FJG3`	Oryza sativa subsp. japonica	sp\|B9FJG3\|RSLE1_ORYSJ Zinc finger BED domain-containing protein RICESLEEPER 1	25.100%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card