TkA07G323450 | RubberDandelionOmics

Gene overview

TkA07G323450

Reference: TK1151 Chr: Chr07 Coordinates: 80938617-80939247 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

564 bp · TkA07G323450|TK1151|cDNA

ATGACAAAAGACTGTCGGCTTCTCGGGACATTCGATCTTTCCGGAATCCCACCCGCACCAAGGGGAACCCCACAAATCGAAGTGACATTTGAAGTGGACGCGAACGGGATCTTGAACGTGAAGGCGGAGGACAAGGCTTCAGGGAAATCGGAAAAGATAACAATAACGAATGAGAAGGGGAGACTGAGTCAGGAGGAGATCGAACGGATGGTAAGGGAAGCAGAGGAGTTTGCGGAAGAAGATAAGAAGGTGAAGGAGAA...

CDS

Download CDS FASTA

564 bp · TkA07G323450|TK1151|CDS

ATGACAAAAGACTGTCGGCTTCTCGGGACATTCGATCTTTCCGGAATCCCACCCGCACCAAGGGGAACCCCACAAATCGAAGTGACATTTGAAGTGGACGCGAACGGGATCTTGAACGTGAAGGCGGAGGACAAGGCTTCAGGGAAATCGGAAAAGATAACAATAACGAATGAGAAGGGGAGACTGAGTCAGGAGGAGATCGAACGGATGGTAAGGGAAGCAGAGGAGTTTGCGGAAGAAGATAAGAAGGTGAAGGAGAA...

Protein

Download Protein FASTA

187 aa · TkA07G323450|TK1151|PROTEIN

MTKDCRLLGTFDLSGIPPAPRGTPQIEVTFEVDANGILNVKAEDKASGKSEKITITNEKGRLSQEEIERMVREAEEFAEEDKKVKEKIDARNALETYVYNMKNQIGDKDKLADKLEGDEKEKIEAATKEALEWLDENQAAEKEEYDEKLKEVEAVCNPIITAVYQRTGGAPGGGAESTEDDDEHDEL

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G323450`
TK1151 ID	TkA07G323450
OH-1004 ID	LXL04_029479
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 28.290 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G323450

Location Chr07:80938617-80939247 (+)

Description Similar to BIP5: Luminal-binding protein 5

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g42020`	In cooperation with other chaperones, Hsp70s are key components that facilitate folding of de novo synthesized proteins, assist translocation of precursor proteins into organelles, and are responsible for degradation of damaged protein under stress conditions (Probable).	Multiple BiP genes of Arabidopsis thaliana are required for male gametogenesis and pollen competitiveness.2014 · DOI: 10.1093/pcp/pcu018 Fertilization-Coupled Sperm Nuclear Fusion Is Required for Normal Endosperm Nuclear Proliferation.2020 · DOI: 10.1093/pcp/pcz158
`At5g28540`	In cooperation with other chaperones, Hsp70s are key components that facilitate folding of de novo synthesized proteins, assist translocation of precursor proteins into organelles, and are responsible for degradation of damaged protein under stress conditions (Probable).	Multiple BiP genes of Arabidopsis thaliana are required for male gametogenesis and pollen competitiveness.2014 · DOI: 10.1093/pcp/pcu018 The THERMOSENSITIVE MALE STERILE 1 Interacts with the BiPs via DnaJ Domain and Stimulates Their ATPase Enzyme Activities in Arabidopsis.2015 · DOI: 10.1371/journal.pone.0132500 Fertilization-Coupled Sperm Nuclear Fusion Is Required for Normal Endosperm Nuclear Proliferation.2020 · DOI: 10.1093/pcp/pcz158

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029479 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006457 protein folding Biological Process

GO:0009408 response to heat Biological Process

GO:0009860 pollen tube growth Biological Process

GO:0030968 endoplasmic reticulum unfolded protein response Biological Process

GO:0034976 response to endoplasmic reticulum stress Biological Process

GO:0036503 ERAD pathway Biological Process

GO:0042026 protein refolding Biological Process

GO:0000325 plant-type vacuole Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005730 nucleolus Cellular Component

GO:0005737 cytoplasm Cellular Component

KEGG gene cross-reference

ath:AT5G28540

ath:AT5G42020

nta:107771425

nta:107818867

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.706

Rank 1 · TkA07G323450 · TK1151

Endoplasmic reticulum0.230

Rank 2 · TkA07G323450 · TK1151

Nucleus0.189

Rank 3 · TkA07G323450 · TK1151

Golgi apparatus0.095

Rank 4 · TkA07G323450 · TK1151

Cell membrane0.089

Rank 5 · TkA07G323450 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00012HSP701-165 aa

PF09746Membralin22-145 aa

PF01196Ribosomal_L1749-99 aa

PF19936DUF639956-102 aa

PF28006HpsJ57-143 aa

PF06098Radial_spoke_358-160 aa

PF27320YurS_helical59-89 aa

PF14226DIOX_N62-121 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G323450	`PF00012`	HSP70	1	165	1.3e-43	149.9
TkA07G323450	`PF09746`	Membralin	22	145	9.8	6.0
TkA07G323450	`PF01196`	Ribosomal_L17	49	99	2.9	9.5
TkA07G323450	`PF19936`	DUF6399	56	102	0.14	12.9
TkA07G323450	`PF28006`	HpsJ	57	143	0.82	10.0
TkA07G323450	`PF06098`	Radial_spoke_3	58	160	0.00072	19.7
TkA07G323450	`PF27320`	YurS_helical	59	89	0.095	13.7
TkA07G323450	`PF14226`	DIOX_N	62	121	0.2	13.1
TkA07G323450	`PF20104`	DUF6494	63	104	0.23	12.5
TkA07G323450	`PF19936`	DUF6399	116	170	0.14	12.9
TkA07G323450	`PF20104`	DUF6494	122	132	0.23	12.5
TkA07G323450	`PF27320`	YurS_helical	132	142	0.095	13.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39043`	Arabidopsis thaliana	sp\|Q39043\|BIP2_ARATH Heat shock 70 kDa protein BIP2	89.900%	Swiss-Prot	High
`Q9LKR3`	Arabidopsis thaliana	sp\|Q9LKR3\|BIP1_ARATH Heat shock 70 kDa protein BIP1	94.200%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card