RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G316120
Reference: TK1151 Chr: Chr07 Coordinates: 79221920-79227211 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2502 bp · TkA07G316120|TK1151|cDNA

TTTCCTTCTTCATTATTTCCCCCCCGATATATGCTTTCATTTATATATAACACACACACACACAATCTCATTTCACACGCTTTCCTCAAAAACTACTGCATGCCTCTCCGCCAGTTGGCTCATAAAAACCCACACACAAATACTATATAAAATACACTTTGATTTTTCAATAATTAATATTCCAACCTACATACCCACTTTCACTCTTCGCTTAAATCGACTAATTCGATTACATCCACATTTCCGCTTTCGTTTTCTGC...

CDS

Download CDS FASTA

1464 bp · TkA07G316120|TK1151|CDS

ATGTGGGTGGTGATAATGTCCGAGAGCTTTGCTTTCCTCTGTAATTTGGGTGTGATGGGGAAGACAAAGATGGGATCTGTTCTTGGATGCATAGGAAAGCTTGTTAATGGCGTTTTGAGCTTTTTTGTGTTTTCTGTACTCGATGTTCTTGATATTTTGTTGTGTTATGTGTACAAGATTATTGATTTTTTCTTGGAAGATGAGTGGAAGCCATGTTACTGTTCTTCATCGAAACAAACGATTATCAATAGAGGTAACAT...

Protein

Download Protein FASTA

487 aa · TkA07G316120|TK1151|PROTEIN

MWVVIMSESFAFLCNLGVMGKTKMGSVLGCIGKLVNGVLSFFVFSVLDVLDILLCYVYKIIDFFLEDEWKPCYCSSSKQTIINRGNILVSEKGEAEKIICLTSTKLHLEEISDTLYSRSSLAVEVSKTTVKRRNVVTSVNKAATVQSPFMVNTTIVEMLQEKIGGRHKPHRFPRWSDCDCDTCNSWSNSCKDTLFVHIGGRKDNVSENVLFIHGFISSSAFWTETLFPNFSKSIKSKYRLFAIDLLGFGKSPKPHDSLYT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G316120
TK1151 IDTkA07G316120
OH-1004 IDLXL04_029452
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)98.800
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G316120
LocationChr07:79221920-79227211 (-)
DescriptionSimilar to BDG1: Probable lysophospholipase BODYGUARD 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At1g64670 Controls cuticle development and morphogenesis, by promoting cutin and suberin monomers loading.
The plant cuticle is required for osmotic stress regulation of abscisic acid biosynthesis and osmotic stress tolerance in Arabidopsis.2011 · DOI: 10.1105/tpc.110.081943
At4g24140 Involved in cuticle development and morphogenesis. No verified direct reference in this release
At5g41900 Involved in cuticle development and morphogenesis. No verified direct reference in this release
At5g17720 Involved in cuticle development and morphogenesis. No verified direct reference in this release
At5g17780 Involved in cuticle development and morphogenesis. No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_029452 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006970 response to osmotic stress Biological Process
GO:0009688 abscisic acid biosynthetic process Biological Process
GO:0009737 response to abscisic acid Biological Process
GO:0010115 regulation of abscisic acid biosynthetic process Biological Process
GO:0010143 cutin biosynthetic process Biological Process
GO:0010148 transpiration Biological Process
GO:0010224 response to UV-B Biological Process
GO:0010345 suberin biosynthetic process Biological Process
GO:0048527 lateral root development Biological Process
GO:0050832 defense response to fungus Biological Process
GO:0071555 cell wall organization Biological Process
GO:1901959 positive regulation of cutin biosynthetic process Biological Process
KEGG gene cross-reference
ath:AT1G64670
ath:AT4G24140
ath:AT5G17720
ath:AT5G17780
ath:AT5G41900
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Endoplasmic reticulum0.311
Rank 1 · TkA07G316120 · TK1151
Golgi apparatus0.173
Rank 2 · TkA07G316120 · TK1151
Nucleus0.153
Rank 3 · TkA07G316120 · TK1151
Cell membrane0.149
Rank 4 · TkA07G316120 · TK1151
Cytoplasm0.134
Rank 5 · TkA07G316120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12146Hydrolase_4206-462 aa
PF29535CMFA_C206-231 aa
PF00561Abhydrolase_1209-465 aa
PF12697Abhydrolase_6209-474 aa
PF02089Palm_thioest209-308 aa
PF00975Thioesterase224-300 aa
PF10230LIDHydrolase230-458 aa
PF06342DUF1057236-325 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G316120PF12146Hydrolase_42064621.7e-1247.9
TkA07G316120PF29535CMFA_C2062310.008816.2
TkA07G316120PF00561Abhydrolase_12094652.6e-29103.3
TkA07G316120PF12697Abhydrolase_62094746e-1557.2
TkA07G316120PF02089Palm_thioest2093080.005717.1
TkA07G316120PF00975Thioesterase2243000.007517.2
TkA07G316120PF10230LIDHydrolase2304583e-0627.9
TkA07G316120PF06342DUF10572363250.0912.5
TkA07G316120PF12695Abhydrolase_52723120.1912.2
TkA07G316120PF00756Esterase2753460.01116.2
TkA07G316120PF29535CMFA_C2763020.008816.2
TkA07G316120PF06821Ser_hydrolase2783382.2e-0525.2
TkA07G316120PF06821Ser_hydrolase4164642.2e-0525.2
TkA07G316120PF12695Abhydrolase_54264610.1912.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q8LFX7Arabidopsis thalianasp|Q8LFX7|BDG1_ARATH Probable lysophospholipase BODYGUARD 156.900%Swiss-ProtHigh
O22977Arabidopsis thalianasp|O22977|BDG3_ARATH Probable lysophospholipase BODYGUARD 353.900%Swiss-ProtHigh
Q9FJ24Arabidopsis thalianasp|Q9FJ24|BDG2_ARATH Probable lysophospholipase BODYGUARD 254.600%Swiss-ProtHigh
Q9FN79Arabidopsis thalianasp|Q9FN79|BDG5_ARATH Probable lysophospholipase BODYGUARD 537.200%Swiss-ProtMedium
Q700D5Arabidopsis thalianasp|Q700D5|BDG4_ARATH Probable lysophospholipase BODYGUARD 437.700%Swiss-ProtMedium

JBrowse

View in Genome Browser