TkA07G273170 | RubberDandelionOmics

Gene overview

TkA07G273170

Reference: TK1151 Chr: Chr07 Coordinates: 68275179-68278100 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2095 bp · TkA07G273170|TK1151|cDNA

TTTTGAGAAACTAGGGGCCGCCATAAACGCCAAATTCGAGTTGTCTTCTTTAGCAGATTCCGATTTTCTGAATATCTATTCGTCCCATAACATCTAGGGTTCATAAATTCAGTTTTTTCGTCATCAATCCTGCTTAACGACAGCATGCGGTTCCATTTATCCCGAGGTTCAGACTGGCACCTCGGCTTCAGAACATTGAATTCGGCGAAATCCAGAATAAAATCCCACTTCCAAATCGCAACGAATCATGGCCACCTTCT...

CDS

Download CDS FASTA

1194 bp · TkA07G273170|TK1151|CDS

ATGCGGTTCCATTTATCCCGAGGTTCAGACTGGCACCTCGGCTTCAGAACATTGAATTCGGCGAAATCCAGAATAAAATCCCACTTCCAAATCGCAACGAATCATGGCCACCTTCTTACAACCAACCACATAGAATCATCTACTCCAAGAACATACACAACCATGCCCGAAAAGATCCCAGAAGATCCACCAAAACCCGACACCATTTCCAACATGTTAATCGACTCATTTGGAAGACAACACACATACTTAAGAATCTC...

Protein

Download Protein FASTA

397 aa · TkA07G273170|TK1151|PROTEIN

MRFHLSRGSDWHLGFRTLNSAKSRIKSHFQIATNHGHLLTTNHIESSTPRTYTTMPEKIPEDPPKPDTISNMLIDSFGRQHTYLRISLTERGNLRCQYCMPAEGVDLTPNPKIMSQSELVRLATLFVHSGVNKIRLTGGEPSIRKDIEEICSQLSNLKGLKTLAMTTNGLTLTRKLPKLQECGLNLLNISLDTLVPAKFEFMTRRKGHERVIESIHKAVELGYNPVKVNCVVMRGFNDDEICDFVELTKEKPVNVRFIEF...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G273170`
TK1151 ID	TkA07G273170
OH-1004 ID	LXL04_010429
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	97.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G273170

Location Chr07:68275179-68278100 (-)

Description Similar to CNX2: GTP 3',8-cyclase, mitochondrial

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g31955`	Catalyzes the cyclization of GTP to (8S)-3',8-cyclo-7,8-dihydroguanosine 5'-triphosphate.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_010429 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006777 Mo-molybdopterin cofactor biosynthetic process Biological Process

GO:0032324 molybdopterin cofactor biosynthetic process Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005759 mitochondrial matrix Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0005525 GTP binding Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0051539 4 iron, 4 sulfur cluster binding Molecular Function

GO:0061798 GTP 3',8'-cyclase activity Molecular Function

GO:0061799 cyclic pyranopterin monophosphate synthase activity Molecular Function

KEGG gene cross-reference

ath:AT2G31955

bta:281917

ddi:DDB_G0285137

hsa:4337

mmu:56738

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Mitochondrion0.886

Rank 1 · TkA07G273170 · TK1151

Plastid0.058

Rank 2 · TkA07G273170 · TK1151

Cytoplasm0.056

Rank 3 · TkA07G273170 · TK1151

Nucleus0.043

Rank 4 · TkA07G273170 · TK1151

Cell membrane0.013

Rank 5 · TkA07G273170 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04055Radical_SAM86-247 aa

PF13353Fer4_1293-200 aa

PF06463Mob_synth_C254-378 aa

PF04055Radical_SAM350-370 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G273170	`PF04055`	Radical_SAM	86	247	1.1e-31	110.9
TkA07G273170	`PF13353`	Fer4_12	93	200	0.00051	21.1
TkA07G273170	`PF06463`	Mob_synth_C	254	378	1e-35	123.2
TkA07G273170	`PF04055`	Radical_SAM	350	370	1.1e-31	110.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q39055`	Arabidopsis thaliana	sp\|Q39055\|MOAA_ARATH GTP 3',8-cyclase	69.800%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card