TkA07G261050 | RubberDandelionOmics

Gene overview

TkA07G261050

Reference: TK1151 Chr: Chr07 Coordinates: 65268939-65271932 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2060 bp · TkA07G261050|TK1151|cDNA

CACTTTTCTAAACGTAAGATATAGTTTTTCAAAAAAGTACTATTTTATGTTACGATACGTAAATATATAAAAGCTGTAGGGCAGTATCTTCTAGAGCCGATTATCTCTCCAACGTTCATACCTCGTCTTCCTCCAAAAAATCAGTAACCGCGATCACATTGTTACATTTGAGCGTCGATACATTTCGATCATACCTCGTCTTCAAATTCGTTTATCGTCACAGCTCTCCCGGAAAATGTCGAGATATTCATTTTCAAAAG...

CDS

Download CDS FASTA

1110 bp · TkA07G261050|TK1151|CDS

ATGTCGAGATATTCATTTTCAAAAGATGTTCAGGTTCCGATATGTGGGATACCATATAACTTGAACAGGGATCTTCTTGCTGCAAGATCATCAAAACTCTGCAAGCTGTTCAAAGAAAACCCGGATGAAGATCTCTCTCATCTTGTTTGCAATATCCCTACAACCCCTCAAGTTTTCGAGCTCATCGCAAGATTTTGCTACGGTCTTGAAGTCAAACTTACACCAGAAAACGTCATTCCAATTTGTTGTTTAGCTTGCTA...

Protein

Download Protein FASTA

369 aa · TkA07G261050|TK1151|PROTEIN

MSRYSFSKDVQVPICGIPYNLNRDLLAARSSKLCKLFKENPDEDLSHLVCNIPTTPQVFELIARFCYGLEVKLTPENVIPICCLACYLGMTDNHSPNNLLTRALSFFEREIITGWNESIRSLKATEDNQLLLQQAVKLGLIDACVDSIISKALNNPIYLPDGRSDENEEQVYKPNARRQLFVVDSEQDQSFLTLTTLGLQFYEPIIRGMIQGKVGSIYIALNLYEYAKKWVFFDPKESDQSSSSSSSQGVYSNSRRDTIE...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G261050`
TK1151 ID	TkA07G261050
OH-1004 ID	LXL04_029649
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	83.700
Protein coverage (%)	TK1151 98.103 / OH-1004 64.338 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G261050

Location Chr07:65268939-65271932 (+)

Description Similar to At3g03510: BTB/POZ domain-containing protein At3g03510

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g03510`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At5g66560`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At5g13600`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At3g50840`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release
`At3g08660`	May act as a substrate-specific adapter of an E3 ubiquitin-protein ligase complex (CUL3-RBX1-BTB) which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_029649 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0016567 protein ubiquitination Biological Process

GO:0005634 nucleus Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT3G03510

ath:AT3G50840

ath:AT5G13600

ath:AT5G17580

ath:AT5G66560

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.476

Rank 1 · TkA07G261050 · TK1151

Cytoplasm0.391

Rank 2 · TkA07G261050 · TK1151

Cell membrane0.099

Rank 3 · TkA07G261050 · TK1151

Endoplasmic reticulum0.063

Rank 4 · TkA07G261050 · TK1151

Lysosome / Vacuole0.054

Rank 5 · TkA07G261050 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00651BTB18-91 aa

PF26378YpfK48-89 aa

PF03000NPH3194-342 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G261050	`PF00651`	BTB	18	91	4.8e-05	24.2
TkA07G261050	`PF26378`	YpfK	48	89	0.0005	21.0
TkA07G261050	`PF03000`	NPH3	194	342	3.7e-34	119.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9SRQ5`	Arabidopsis thaliana	sp\|Q9SRQ5\|Y3351_ARATH BTB/POZ domain-containing protein At3g03510	34.400%	Swiss-Prot	Medium
`Q94A73`	Arabidopsis thaliana	sp\|Q94A73\|Y5656_ARATH BTB/POZ domain-containing protein At5g66560	34.200%	Swiss-Prot	Medium
`Q9FNB3`	Arabidopsis thaliana	sp\|Q9FNB3\|Y5360_ARATH Putative BTB/POZ domain-containing protein At5g13600	29.300%	Swiss-Prot	Low
`Q8LPQ3`	Arabidopsis thaliana	sp\|Q8LPQ3\|Y3084_ARATH BTB/POZ domain-containing protein At3g50840	28.500%	Swiss-Prot	Low
`Q9C9Z0`	Arabidopsis thaliana	sp\|Q9C9Z0\|Y3866_ARATH Putative BTB/POZ domain-containing protein At3g08660	27.900%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card