TkA07G260880 | RubberDandelionOmics

Gene overview

TkA07G260880

Reference: TK1151 Chr: Chr07 Coordinates: 65217326-65219129 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1345 bp · TkA07G260880|TK1151|cDNA

CGGACTTTCACCCATTTGAACTATTCCACCTCAAGTAATATGACCGTTACCAAATCATGACGACCTTTTTCCTTCAAACGCATTTCAAATAGTTTAAGCCGTTGCCCCAAATTCCATCAACAAAATCTCGATTCTCCACCATTCTTTCCACTCAATTTCACCTCCTCAAACTCTCTCTCAAAGTTACAGCCTCCAACTTCACTCTGCTCCAATGGCGCTTAGAGCTCTTGATAACACACTGCCCTTAACCCCTGAACGCC...

CDS

Download CDS FASTA

933 bp · TkA07G260880|TK1151|CDS

ATGGCGCTTAGAGCTCTTGATAACACACTGCCCTTAACCCCTGAACGCCCTAAAAAGATTATCAAAGTTTCGAATTCCATCGCTAAACCTAAACAGCCCGCAGATTCGAATGTTAATAACGAAAACGTAGCTCCTATGGATCCTGTTGCTCCTGCCGTGGATTCAGTTGATTACGTCTCTTCTGAAGATCTAAAACCCCTTTCTGACCCTGATGTCAAGTTCCAGGGCCTAATCGAAGGACTGGAGTCCAAGGACTGGCT...

Protein

Download Protein FASTA

310 aa · TkA07G260880|TK1151|PROTEIN

MALRALDNTLPLTPERPKKIIKVSNSIAKPKQPADSNVNNENVAPMDPVAPAVDSVDYVSSEDLKPLSDPDVKFQGLIEGLESKDWLKVCESLNDVRRMALHHSTLLLPILEKVVLVLVKSMKNPRSALCKTSIMAASDVFKSYGDKLLESTTCDAVDHMILQLLLKASQDKKFVCEEAEKTLKTMVAFIAPIPLLHKLKAYVSHGNMRVRAKAAVSISHSVSKMNVGEMREYGVVVLVKMAAELLKDRLPEAREAARSM...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G260880`
TK1151 ID	TkA07G260880
OH-1004 ID	LXL04_029004
Relationship / confidence	Rbh Sequence Supported / Probable
Protein identity (%)	92.400
Protein coverage (%)	TK1151 88.710 / OH-1004 81.361 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G260880`
Location	Chr07:65217326-65219129 (+)
Description	Similar to Togaram1: TOG array regulator of axonemal microtubules protein 1
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_029004` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0000226 microtubule cytoskeleton organization Biological Process GO:0031116 positive regulation of microtubule polymerization Biological Process GO:0035082 axoneme assembly Biological Process GO:0060271 cilium assembly Biological Process GO:1905515 non-motile cilium assembly Biological Process GO:0005881 cytoplasmic microtubule Cellular Component GO:0005929 cilium Cellular Component GO:0005930 axoneme Cellular Component GO:0036064 ciliary basal body Cellular Component GO:0008017 microtubule binding Molecular Function
KEGG gene cross-reference	hsa:165186 hsa:23116 mmu:320159 mmu:328108 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.683

Rank 1 · TkA07G260880 · TK1151

Cytoplasm0.357

Rank 2 · TkA07G260880 · TK1151

Cell membrane0.036

Rank 3 · TkA07G260880 · TK1151

Mitochondrion0.035

Rank 4 · TkA07G260880 · TK1151

Endoplasmic reticulum0.032

Rank 5 · TkA07G260880 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF23227HEAT_MROH2B_C75-190 aa

PF24987HEAT_EF3_N77-126 aa

PF12348CLASP_N107-268 aa

PF24987HEAT_EF3_N162-192 aa

PF20123DUF6513179-195 aa

PF24987HEAT_EF3_N186-270 aa

PF23227HEAT_MROH2B_C201-263 aa

PF20123DUF6513230-262 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G260880	`PF23227`	HEAT_MROH2B_C	75	190	0.057	13.5
TkA07G260880	`PF24987`	HEAT_EF3_N	77	126	0.13	13.0
TkA07G260880	`PF12348`	CLASP_N	107	268	4.1e-07	30.5
TkA07G260880	`PF24987`	HEAT_EF3_N	162	192	0.13	13.0
TkA07G260880	`PF20123`	DUF6513	179	195	0.25	12.4
TkA07G260880	`PF24987`	HEAT_EF3_N	186	270	0.13	13.0
TkA07G260880	`PF23227`	HEAT_MROH2B_C	201	263	0.057	13.5
TkA07G260880	`PF20123`	DUF6513	230	262	0.25	12.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card