Gene Card
Gene overview
cDNA / CDS / Protein Sequences
2286 bp · TkA07G254370|TK1151|cDNA
AAAAATATTTGTAAAGCGAGAAGGCGATTTCACTTCGAGGTTTTCACCATCTTTGTTGGTCTCCGTCCGTTGTCGTCCAATGAACGGTTGAGTACGTGACTACACAACTTCAAAAGAAATTTTTCCCCAAATCATCAAATTATTTCACCCACGCATACGTCCGACGGGGAAAAGTTTTATACAGATAAAGATTCAGCTTTTCATTGGAAAACATAAAAGGGTTTTGCGAATTTATACAAGTAAAAAAGTTTCGATCTTTT...
1461 bp · TkA07G254370|TK1151|CDS
ATGTCCAACTCCGGAATGAATTACGGCCGGGAAGGTGGTGGTGCAGGCACAATTCTAACACCAGCAAGGTTCGTGTGGCCATACGGCGGAAGAAGTGTATACTTAAGCGGTTCTTTCACAGGGTGGTCTGAGCATTGGCCAATGACGCCGGTTGAGGGATGCCCTACTGTGTTTCAGACGATATGCAGCTTACCACCTGGTTACCATCAGTATAAGTTTATCGTTGATGGTGAATGGCGGCATGATGAACACCAACCTTT...
Protein
Download Protein FASTA486 aa · TkA07G254370|TK1151|PROTEIN
MSNSGMNYGREGGGAGTILTPARFVWPYGGRSVYLSGSFTGWSEHWPMTPVEGCPTVFQTICSLPPGYHQYKFIVDGEWRHDEHQPFVTGNYGTVNTILLSREPDFNPAVLTSGSSMDVDNEVFQRVVRVSDATPFDPLVRVSEADLAVSRQRISVFLSTHMAYELLPESGKVIALDVELPVKQAFHILYEQGISTAPLWDFSKGQFVGVLSALDFILIMRELGSHGSNLTEEELETHTISAWKEAKLYLSKQTSDHGKV...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G254370 |
|---|---|
| TK1151 ID | TkA07G254370 |
| OH-1004 ID | LXL04_028953 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 98.400 |
| Protein coverage (%) | TK1151 99.794 / OH-1004 94.175Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G254370 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr07:63461300-63465183 (+) | |||||||||
| Description | Similar to SNF4: Sucrose nonfermenting 4-like protein | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000266 mitochondrial fission Biological Process GO:0005977 glycogen metabolic process Biological Process GO:0006110 regulation of glycolytic process Biological Process GO:0006633 fatty acid biosynthetic process Biological Process GO:0006754 ATP biosynthetic process Biological Process GO:0009859 pollen hydration Biological Process GO:0016126 sterol biosynthetic process Biological Process GO:0016559 peroxisome fission Biological Process GO:0019217 regulation of fatty acid metabolic process Biological Process GO:0031669 cellular response to nutrient levels Biological Process GO:0035556 intracellular signal transduction Biological Process GO:0042149 cellular response to glucose starvation Biological Process | |||||||||
| KEGG gene cross-reference | ath:AT1G09020 bta:282324 hsa:51422 mmu:108099 pon:100173926 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF16561AMPK1_CBM21-105 aaPF00571CBS172-219 aaPF00571CBS260-317 aaPF00571CBS352-399 aaPF00571CBS437-485 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G254370 | PF16561 | AMPK1_CBM | 21 | 105 | 3.3e-27 | 95.2 |
| TkA07G254370 | PF00571 | CBS | 172 | 219 | 3.8e-26 | 91.9 |
| TkA07G254370 | PF00571 | CBS | 260 | 317 | 3.8e-26 | 91.9 |
| TkA07G254370 | PF00571 | CBS | 352 | 399 | 3.8e-26 | 91.9 |
| TkA07G254370 | PF00571 | CBS | 437 | 485 | 3.8e-26 | 91.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.