TkA07G243270 | RubberDandelionOmics

Gene overview

TkA07G243270

Reference: TK1151 Chr: Chr07 Coordinates: 60722142-60725838 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1706 bp · TkA07G243270|TK1151|cDNA

CGAAGCAAGTCAGCAGCCATGGCACCTGGTTTGAAAGTTGACTCGGAGTCAAAGTAAAAAGTAGCGAATGGTTTTCCATGGATAAGTATAAAACTCTGTCATCACACGTCACTCCAGATCGTATTATGCATCGGACCTGCCGTACTAGCACCCTTCAACAGTTTTCTTTCCCGTCGACCTTCTTTCCTACCCCACCATCTATATGACCCAAACTCTTTAGGTCTTCCTGGCGCACCGCAATTCTGATTTGCTGTTCGCTT...

CDS

Download CDS FASTA

1080 bp · TkA07G243270|TK1151|CDS

ATGGGTACATACCTCAGCACTCCGAAAACAGAAAAATTCTCCGAAGATGGTGAGAATGGGAGGGTCAAATACGGGCTATCATCAATGCAAGGATGGCGTGCAACAATGGAAGATGCTCATGCAGCACTTCCTGATCTGGACCATTCTACCTCTTTCTTTGGCGTATATGATGGCCATGGAGGTAAAGTGGTTGCGAAGTTTTGTGCCAAATTTCTACATCAACAAGTGCTGAAGCATGAAGCATATGCTAGTGGGGATAT...

Protein

Download Protein FASTA

359 aa · TkA07G243270|TK1151|PROTEIN

MGTYLSTPKTEKFSEDGENGRVKYGLSSMQGWRATMEDAHAALPDLDHSTSFFGVYDGHGGKVVAKFCAKFLHQQVLKHEAYASGDIETSVEKAFIRMDEMMRGQRGWRELSVLGDKMNKFSGVIENLIWSPKSGGPETSHQLDDWPFEEGPHSDFTGPTSGCTACVAIMRNNQLIVANAGDSRCVISRKGEAYNLSRDHKPGLEVERDRILKAGGFIHAGRVNGSLNLTRAIGDMEFKQNKFLSAEKQIVTAYPDVNIV...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G243270`
TK1151 ID	TkA07G243270
OH-1004 ID	LXL04_028867
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G243270

Location Chr07:60722142-60725838 (+)

Description Similar to PPC4-2: Probable protein phosphatase 2C 21

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g25070`	Probable protein phosphatase 2C 21.	No verified direct reference in this release
`At4g31860`	Probable protein phosphatase 2C 60.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0180000`	Probable protein phosphatase 2C 11.	No verified direct reference in this release
`Os06g0651600`	Probable protein phosphatase 2C 58.	No verified direct reference in this release
`Os09g0558000`	Probable protein phosphatase 2C 70.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028867 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0007165 signal transduction Biological Process

GO:0005634 nucleus Cellular Component

GO:0005773 vacuole Cellular Component

GO:0005886 plasma membrane Cellular Component

GO:0004722 protein serine/threonine phosphatase activity Molecular Function

GO:0046872 metal ion binding Molecular Function

KEGG gene cross-reference

ath:AT2G25070

ath:AT4G31860

dosa:Os02g0180000

dosa:Os06g0651600

dosa:Os09g0558000

osa:4328505

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.551

Rank 1 · TkA07G243270 · TK1151

Nucleus0.413

Rank 2 · TkA07G243270 · TK1151

Cell membrane0.141

Rank 3 · TkA07G243270 · TK1151

Mitochondrion0.086

Rank 4 · TkA07G243270 · TK1151

Endoplasmic reticulum0.079

Rank 5 · TkA07G243270 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00481PP2C23-104 aa

PF13672PP2C_254-201 aa

PF00481PP2C159-316 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G243270	`PF00481`	PP2C	23	104	1e-73	248.9
TkA07G243270	`PF13672`	PP2C_2	54	201	0.075	13.3
TkA07G243270	`PF00481`	PP2C	159	316	1e-73	248.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81716`	Arabidopsis thaliana	sp\|O81716\|P2C21_ARATH Probable protein phosphatase 2C 21	76.500%	Swiss-Prot	High
`Q9SZ53`	Arabidopsis thaliana	sp\|Q9SZ53\|P2C60_ARATH Probable protein phosphatase 2C 60	78.400%	Swiss-Prot	High
`Q6ETK3`	Oryza sativa subsp. japonica	sp\|Q6ETK3\|P2C11_ORYSJ Probable protein phosphatase 2C 11	77.900%	Swiss-Prot	High
`Q67UP9`	Oryza sativa subsp. japonica	sp\|Q67UP9\|P2C58_ORYSJ Probable protein phosphatase 2C 58	75.500%	Swiss-Prot	High
`Q653S3`	Oryza sativa subsp. japonica	sp\|Q653S3\|P2C70_ORYSJ Probable protein phosphatase 2C 70	71.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card