TkA07G190040 | RubberDandelionOmics

Gene overview

TkA07G190040

Reference: TK1151 Chr: Chr07 Coordinates: 48342653-48345203 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1390 bp · TkA07G190040|TK1151|cDNA

CCACCATTTTTAAATTTGATCAAAGACCCTGATGCTAAAATTGGATCTTCAAAAACCTTGAATTGACATTTGCACCCACTCATTTCTGGCTGGCATCTACATAACTGTCATTGAGGATCATCATTTTGGTTTTCCGGCATTGTACGTGGCCGCAAGTCAAATAGTTCTACAATGGCCAACAAATCAGCCGTTAGCGGCGCTGGGGGCAACGGCGGCGGCAGCAACGTTAGCCCAATCAATCGGAAGAATCAGTTCCGTGG...

CDS

Download CDS FASTA

1041 bp · TkA07G190040|TK1151|CDS

ATGAATCCCAACTCCCTCCCTTCGTCTCCTCTTGCATCTTCTTCTGCTCCAGGATCATCATTTTGGTTTTCCGGCATTGTACGTGGCCGCAAGTCAAATAGTTCTACAATGGCCAACAAATCAGCCGTTAGCGGCGCTGGGGGCAACGGCGGCGGCAGCAACGTTAGCCCAATCAATCGGAAGAATCAGTTCCGTGGTATCATGTTCAAGTACGGCTCTAAGCCTGCTCAGGTTGCATTCAAAACCGGGGATTATAAACA...

Protein

Download Protein FASTA

346 aa · TkA07G190040|TK1151|PROTEIN

MNPNSLPSSPLASSSAPGSSFWFSGIVRGRKSNSSTMANKSAVSGAGGNGGGSNVSPINRKNQFRGIMFKYGSKPAQVAFKTGDYKQQVVFIGGLTDGFLATEYLEPLAIALDKEKWSLVQFLLSSSYTGYGISSLKEDASELDQLINYLINKEDSEGVVLLGHSTGCQDIVHYMRTNAACSRAVRAAILQAPVSDREFRATLPETAGMIDLASKLLSEGRGSELMPREANPDTPITAYRFHSLCAYMGDDDMFSSDLSD...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G190040`
TK1151 ID	TkA07G190040
OH-1004 ID	LXL04_028699
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G190040`
Location	Chr07:48342653-48345203 (-)
Description	Similar to SPAPB24D3.06c: UPF0613 protein PB24D3.06c (Schizosaccharomyces pombe (strain 972 / ATCC 24843)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_028699` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0005634 nucleus Cellular Component GO:0005829 cytosol Cellular Component GO:0016787 hydrolase activity Molecular Function
KEGG gene cross-reference	afm:AFUA_3G03390 ani:ANIA_06793 spo:2543543 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.868

Rank 1 · TkA07G190040 · TK1151

Cytoplasm0.107

Rank 2 · TkA07G190040 · TK1151

Mitochondrion0.072

Rank 3 · TkA07G190040 · TK1151

Peroxisome0.065

Rank 4 · TkA07G190040 · TK1151

Nucleus0.057

Rank 5 · TkA07G190040 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08538DUF174965-304 aa

PF00561Abhydrolase_189-210 aa

PF12146Hydrolase_4134-285 aa

PF05990DUF900135-197 aa

PF12697Abhydrolase_6139-323 aa

PF10230LIDHydrolase139-176 aa

PF02450LCAT141-178 aa

PF06821Ser_hydrolase155-205 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G190040	`PF08538`	DUF1749	65	304	5.7e-69	233.2
TkA07G190040	`PF00561`	Abhydrolase_1	89	210	0.21	11.9
TkA07G190040	`PF12146`	Hydrolase_4	134	285	0.0033	17.5
TkA07G190040	`PF05990`	DUF900	135	197	0.0019	18.4
TkA07G190040	`PF12697`	Abhydrolase_6	139	323	0.00013	23.4
TkA07G190040	`PF10230`	LIDHydrolase	139	176	0.22	11.9
TkA07G190040	`PF02450`	LCAT	141	178	0.13	12.1
TkA07G190040	`PF06821`	Ser_hydrolase	155	205	0.00039	21.1
TkA07G190040	`PF10230`	LIDHydrolase	238	271	0.22	11.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card