Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1438 bp · TkA07G175550|TK1151|cDNA
GGATAAACCATTTATTAAAATTTTTTAAACTAACTTGGTTTTTTCGAAAACCATATCTAGGTTTTTTTATTTATTTATATGTTTTTCAAATAATTATGTAAACAATCTTGGGCCCTGGATTAAATAATCCACCTATTAAAGCTCTTAGGTGCATTCAGTCATTCAGACATAATCCATTTTGGGCTGAATGGGCCAGATCAAGGTCTCAGAATCGATTACCCGAGCGAAACCTGACCTGCATCGAGATGCGAATCCGTAAA...
885 bp · TkA07G175550|TK1151|CDS
ATGGACAACAGAAGGTATAACGGCAGACACGACATACGTAGAAGACAACAGAAAGCAGATGAGGAAGACGAGGCTTCTGTTCTTGAGGAATTTGCAGAGGAATTCCGCCTCCCAATTCATCACAGACCAACAGAAAACGTAGATCTTGATAATGTCCAACAGGCTTCATTAGACACACAATTAACATCATCCAATGTTGGTTTCCGCCTTCTTCAAAAAATGGGGTGGAAAGGGAAAGGTCTTGGCAAAAATGAACAAGG...
Protein
Download Protein FASTA294 aa · TkA07G175550|TK1151|PROTEIN
MDNRRYNGRHDIRRRQQKADEEDEASVLEEFAEEFRLPIHHRPTENVDLDNVQQASLDTQLTSSNVGFRLLQKMGWKGKGLGKNEQGITEPIKSGIRDSKLGVGKQEQDDFFTAEENIQRRKLDIEVEETEETAKKREVMADREQKIQTEVKEIRKTFYCELCNKQYKLAVEFEGHLSSYDHNHRKRFKEMREMHGSSTRDDRQKREQLRQEKEMAKFAQMADAHKQQQQQQKDESENSDLAVKKNVLADQDQRKVLKFG...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G175550 |
|---|---|
| TK1151 ID | TkA07G175550 |
| OH-1004 ID | LXL04_028631 |
| Relationship / confidence | Multi Candidate From Tk1151 / Complex relationship |
| Protein identity (%) | 97.600 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 100.000Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G175550 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr07:44951255-44953474 (+) | |||||||||
| Description | Similar to GPATCH8: G patch domain-containing protein 8 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0000398 mRNA splicing, via spliceosome Biological Process GO:0010628 positive regulation of gene expression Biological Process GO:0005634 nucleus Cellular Component GO:0005737 cytoplasm Cellular Component GO:0005886 plasma membrane Cellular Component GO:0003723 RNA binding Molecular Function GO:0003729 mRNA binding Molecular Function GO:0008270 zinc ion binding Molecular Function | |||||||||
| KEGG gene cross-reference | hsa:219578 hsa:23131 hsa:91752 mmu:237943 mmu:241514 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF15473PCNP25-25 aaPF01585G-patch64-104 aaPF12656G-patch_267-107 aaPF15473PCNP133-133 aaPF05129Zn_ribbon_Elf1138-174 aaPF07535zf-DBF155-183 aaPF25095C2H2-zf_KIN17158-184 aaPF12171zf-C2H2_jaz158-183 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G175550 | PF15473 | PCNP | 25 | 25 | 5.6 | 8.3 |
| TkA07G175550 | PF01585 | G-patch | 64 | 104 | 3.2e-16 | 59.7 |
| TkA07G175550 | PF12656 | G-patch_2 | 67 | 107 | 2.4e-05 | 25.0 |
| TkA07G175550 | PF15473 | PCNP | 133 | 133 | 5.6 | 8.3 |
| TkA07G175550 | PF05129 | Zn_ribbon_Elf1 | 138 | 174 | 0.051 | 14.4 |
| TkA07G175550 | PF07535 | zf-DBF | 155 | 183 | 0.0098 | 16.6 |
| TkA07G175550 | PF25095 | C2H2-zf_KIN17 | 158 | 184 | 0.00065 | 20.6 |
| TkA07G175550 | PF12171 | zf-C2H2_jaz | 158 | 183 | 0.0011 | 19.7 |
| TkA07G175550 | PF12874 | zf-met | 158 | 179 | 0.049 | 14.7 |
| TkA07G175550 | PF15473 | PCNP | 201 | 294 | 5.6 | 8.3 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.