TkA07G164080 | RubberDandelionOmics

Gene overview

TkA07G164080

Reference: TK1151 Chr: Chr07 Coordinates: 42172241-42176026 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1734 bp · TkA07G164080|TK1151|cDNA

AGAATATCCAACCAGATTGCAGAGGACGGAAATCACTGTTCCACCGTGCGTCGATAATGATTTTTCAAATCACACATGGGACCTCTCACCCGATCACTAATAAGTTCGCCCTTCCTCCTTTCTTCAACTCCACTCCTCTGTCTTTAAATCTCATATCCAGTGAAGAAGACCTCAACAAAAACTCTGATCCAAATTCAACGAGGGGATTTCCAAAATGGGTGTACTATCATGGCCATCTGATTCAGAGTTGGATAAAATCA...

CDS

Download CDS FASTA

1266 bp · TkA07G164080|TK1151|CDS

ATGGGTGTACTATCATGGCCATCTGATTCAGAGTTGGATAAAATCAAGACGACGGTTGCTGAAATGGCTGGAGTAGCTGTTGATGTTGTTAGAGTTGCTGTATCCCCTTACAGGATTTGCCCGCTGGGAGCGCATATTGACCATCAGGGTGGGACGGTTTCAGCCATGACAATCGACAAGGGCATAATTCTTGGATTTGTGCCTTCTGCTGATTCTCAGGTTCTTCTAAGGTCTGGACAATTTAATGGAGAAGTTCGTTT...

Protein

Download Protein FASTA

421 aa · TkA07G164080|TK1151|PROTEIN

MGVLSWPSDSELDKIKTTVAEMAGVAVDVVRVAVSPYRICPLGAHIDHQGGTVSAMTIDKGIILGFVPSADSQVLLRSGQFNGEVRFRVDQIQLPNHIAESKEECKWGSYAKGALYALQRGGNNLKQGITGFICGTKGLDSSGLSSSAAVGVAYLLALESANNLSISPTENIEYDRLIENEYLGLKNGILDQSAILLSSYGCLTCMDCKTKKHKLIQAPAKREMEKKGEYKILLAFSGLKQALTTNPGYNTRVSECREAA...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G164080`
TK1151 ID	TkA07G164080
OH-1004 ID	LXL04_028507
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G164080

Location Chr07:42172241-42176026 (-)

Description Similar to GALAK: Galacturonokinase

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g10700`	May act as a sugar-1-kinase using α-D-galacturonic acid and ATP as substrates.	Identification of galacturonic acid-1-phosphate kinase, a new member of the GHMP kinase superfamily in plants, and comparison with galactose-1-phosphate kinase.2009 · DOI: 10.1074/jbc.m109.014761

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_028507 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006012 galactose metabolic process Biological Process

GO:0046396 D-galacturonate metabolic process Biological Process

GO:0046835 carbohydrate phosphorylation Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0000287 magnesium ion binding Molecular Function

GO:0004335 galactokinase activity Molecular Function

GO:0005524 ATP binding Molecular Function

GO:0046872 metal ion binding Molecular Function

GO:0047912 galacturonokinase activity Molecular Function

KEGG gene cross-reference

ath:AT3G10700

lca:LSEI_0664

lcb:LCABL_07300

tte:TTE1928

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.687

Rank 1 · TkA07G164080 · TK1151

Nucleus0.266

Rank 2 · TkA07G164080 · TK1151

Mitochondrion0.138

Rank 3 · TkA07G164080 · TK1151

Peroxisome0.088

Rank 4 · TkA07G164080 · TK1151

Cell membrane0.077

Rank 5 · TkA07G164080 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF10509GalKase_gal_bdg32-64 aa

PF00288GHMP_kinases_N110-197 aa

PF08544GHMP_kinases_C314-392 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G164080	`PF10509`	GalKase_gal_bdg	32	64	0.0055	17.0
TkA07G164080	`PF00288`	GHMP_kinases_N	110	197	6e-10	39.9
TkA07G164080	`PF08544`	GHMP_kinases_C	314	392	1.6e-10	42.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8VYG2`	Arabidopsis thaliana	sp\|Q8VYG2\|GALAK_ARATH Galacturonokinase	71.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card