TkA07G132580 | RubberDandelionOmics

Gene overview

TkA07G132580

Reference: TK1151 Chr: Chr07 Coordinates: 34396585-34401552 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1794 bp · TkA07G132580|TK1151|cDNA

ATGATCAATGCGATTATTACTGTGATGGATCTTTCAAAGTTTAATCAACAAGAGGAATTAGTGAAGAAACATTCAGAAGATGTCCAAGAGATAAGGAAGGAGTTAATGACTTCCATCTCCACTCTCCAAGCCGATTTCACATCTAAGGTCCGAATCAAAGAGCTTGTAACTCAACTGGAGTCCAAGTCTCATGAGGCTGAACATAAGCAGAGAGTGGTGGACATGTACAAAGTCCAAAACCAAGAAATTAACTTGAAACT...

CDS

Download CDS FASTA

1794 bp · TkA07G132580|TK1151|CDS

ATGATCAATGCGATTATTACTGTGATGGATCTTTCAAAGTTTAATCAACAAGAGGAATTAGTGAAGAAACATTCAGAAGATGTCCAAGAGATAAGGAAGGAGTTAATGACTTCCATCTCCACTCTCCAAGCCGATTTCACATCTAAGGTCCGAATCAAAGAGCTTGTAACTCAACTGGAGTCCAAGTCTCATGAGGCTGAACATAAGCAGAGAGTGGTGGACATGTACAAAGTCCAAAACCAAGAAATTAACTTGAAACT...

Protein

Download Protein FASTA

597 aa · TkA07G132580|TK1151|PROTEIN

MINAIITVMDLSKFNQQEELVKKHSEDVQEIRKELMTSISTLQADFTSKVRIKELVTQLESKSHEAEHKQRVVDMYKVQNQEINLKLVKLVEDKDAQFKQLSEKIDSKFELMLTLQENSKIATESKKEAQGCIYNASYDTQFGFCCDIDEETSQKLAGLPEVLSINPDPDFNSIQKDYTNEKTESHSSNKLKNWLVRVEMPPLAVITRAQLVDYYTQILTKVLGNFLNRKFAAGVPGVISVRPDESFDSDDKNYGVHSKH...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G132580`
TK1151 ID	TkA07G132580
OH-1004 ID	LXL04_003015
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	33.600
Protein coverage (%)	TK1151 99.832 / OH-1004 78.550 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G132580

Location Chr07:34396585-34401552 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At3g20930`	Involved in C-to-U editing of chloroplastic RNA.	An RNA recognition motif-containing protein is required for plastid RNA editing in Arabidopsis and maize.2013 · DOI: 10.1073/pnas.1220162110
`At1g32580`	Involved in organellar RNA editing.	No verified direct reference in this release
`At2g35240`	Involved in organellar RNA editing.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os02g0730800`	Involved in C-to-U editing of chloroplastic RNA.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_003015 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source) No functional description available

KEGG gene cross-reference No functional description available

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.517

Rank 1 · TkA07G132580 · TK1151

Nucleus0.411

Rank 2 · TkA07G132580 · TK1151

Mitochondrion0.080

Rank 3 · TkA07G132580 · TK1151

Cell membrane0.071

Rank 4 · TkA07G132580 · TK1151

Endoplasmic reticulum0.056

Rank 5 · TkA07G132580 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06785UPF024212-120 aa

PF11865mTOR_dom19-91 aa

PF21864MORF_dom60-77 aa

PF06639BAP102-152 aa

PF05922Inhibitor_I9117-168 aa

PF21864MORF_dom122-182 aa

PF21864MORF_dom192-225 aa

PF11865mTOR_dom200-228 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G132580	`PF06785`	UPF0242	12	120	0.35	11.6
TkA07G132580	`PF11865`	mTOR_dom	19	91	0.19	12.4
TkA07G132580	`PF21864`	MORF_dom	60	77	6.7e-33	113.1
TkA07G132580	`PF06639`	BAP	102	152	0.087	13.9
TkA07G132580	`PF05922`	Inhibitor_I9	117	168	0.017	16.5
TkA07G132580	`PF21864`	MORF_dom	122	182	6.7e-33	113.1
TkA07G132580	`PF21864`	MORF_dom	192	225	6.7e-33	113.1
TkA07G132580	`PF11865`	mTOR_dom	200	228	0.19	12.4
TkA07G132580	`PF21864`	MORF_dom	233	257	6.7e-33	113.1
TkA07G132580	`PF05922`	Inhibitor_I9	236	246	0.017	16.5
TkA07G132580	`PF06785`	UPF0242	388	439	0.35	11.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L440`	Arabidopsis thaliana	sp\|Q8L440\|ORRM1_ARATH Organelle RRM domain-containing protein 1, chloroplastic	33.300%	Swiss-Prot	Low
`Q9C7Y2`	Arabidopsis thaliana	sp\|Q9C7Y2\|MORF5_ARATH Multiple organellar RNA editing factor 5, chloroplastic/mitochondrial	55.600%	Swiss-Prot	Low
`O82169`	Arabidopsis thaliana	sp\|O82169\|MORF6_ARATH Multiple organellar RNA editing factor 6, mitochondrial	53.700%	Swiss-Prot	Low
`Q6YWP9`	Oryza sativa subsp. japonica	sp\|Q6YWP9\|ORRM1_ORYSJ Organelle RRM domain-containing protein 1, chloroplastic	36.400%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card