RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G131120
Reference: TK1151 Chr: Chr07 Coordinates: 33885693-33888680 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

2919 bp · TkA07G131120|TK1151|cDNA

CTTGAAAATACTCCACTCAATTAGCATAGTAGATCGGCAGTGGACGGCGGTGGGTGGGTGGGTGGTGGTGTTTGGATTAAACTAACATTGATGATAAATCGAAGCGGTTGAAAACTCTTTTTCCGACCATGGGGTTTGCTCTCTTGGGTTCAATTGTGGTTCTAACTCTGTTCTTTTGGTCAAACCTTGGTCAACAACAAGAACAGCACACACCCATTCCCAATACAGATGAGTTCTTCATCTTTGATTTCTTTCAAAAA...

CDS

Download CDS FASTA

2565 bp · TkA07G131120|TK1151|CDS

ATGGGGTTTGCTCTCTTGGGTTCAATTGTGGTTCTAACTCTGTTCTTTTGGTCAAACCTTGGTCAACAACAAGAACAGCACACACCCATTCCCAATACAGATGAGTTCTTCATCTTTGATTTCTTTCAAAAAATGGGTGCAATGAATTCGTCTTCTTTTTCTCATGTTTACAATTTTTCATCCCCCTTTTGTTCATCGCAAATTGTTTTCTGTGATGCCAATCAAGAACATGTCGTAGGTCTAAATGCTCGTAATTTGGG...

Protein

Download Protein FASTA

854 aa · TkA07G131120|TK1151|PROTEIN

MGFALLGSIVVLTLFFWSNLGQQQEQHTPIPNTDEFFIFDFFQKMGAMNSSSFSHVYNFSSPFCSSQIVFCDANQEHVVGLNARNLGLSGSIPDNTIGKLTKLQSLDLSNNQIVNLPDDFWSLGSLKTLNLSNNKISMNLPSNIGNFGSLEILDLSVNNFFGSFPESISSLISLQVLNLNRNGFESTVPLGIVSCKSLISLDFSSNGFNGSLPDGFGSSFPKLKSLNLAGNAMRGSVVEIFRESLEVVDLSSNHIEGHIS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G131120
TK1151 IDTkA07G131120
OH-1004 IDLXL04_028213
Relationship / confidenceRbh High Identity Coverage Synteny / Strict
Protein identity (%)99.200
Protein coverage (%)TK1151 100.000 / OH-1004 100.000
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G131120
LocationChr07:33885693-33888680 (-)
DescriptionSimilar to At2g24230: Probable LRR receptor-like serine/threonine-protein kinase At2g24230
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At2g24230 Probable LRR receptor-like serine/threonine-protein kinase At2g24230. No verified direct reference in this release
At5g58150 Probably inactive leucine-rich repeat receptor-like protein kinase At5g58150. No verified direct reference in this release
At5g45800 Can phosphorylate the myelin basic protein in vitro.
A receptor-like kinase from Arabidopsis thaliana is a calmodulin-binding protein.2004 · DOI: 10.1042/bj20031045

Rice

Reference gene IDPossible functionPapers / DOI
Os09g0293500 May be involved in brassenosteroid (BR) perception in roots.
The role of OsBRI1 and its homologous genes, OsBRL1 and OsBRL3, in rice.2006 · DOI: 10.1104/pp.105.072330
Os08g0342300 May be involved in brassenosteroid (BR) perception in roots.
The role of OsBRI1 and its homologous genes, OsBRL1 and OsBRL3, in rice.2006 · DOI: 10.1104/pp.105.072330
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_028213 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0009556 microsporogenesis Biological Process
GO:0010234 anther wall tapetum cell fate specification Biological Process
GO:0045088 regulation of innate immune response Biological Process
GO:0046777 protein autophosphorylation Biological Process
GO:0000325 plant-type vacuole Cellular Component
GO:0005886 plasma membrane Cellular Component
GO:0016020 membrane Cellular Component
GO:0004672 protein kinase activity Molecular Function
GO:0004674 protein serine/threonine kinase activity Molecular Function
GO:0005524 ATP binding Molecular Function
GO:0019199 transmembrane receptor protein kinase activity Molecular Function
GO:0106310 protein serine kinase activity Molecular Function
KEGG gene cross-reference
ath:AT2G24230
ath:AT5G07280
ath:AT5G58150
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.854
Rank 1 · TkA07G131120 · TK1151
Endoplasmic reticulum0.090
Rank 2 · TkA07G131120 · TK1151
Cytoplasm0.072
Rank 3 · TkA07G131120 · TK1151
Nucleus0.059
Rank 4 · TkA07G131120 · TK1151
Lysosome / Vacuole0.028
Rank 5 · TkA07G131120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF12799LRR_481-117 aa
PF00560LRR_181-94 aa
PF23211LRR_LRWD188-162 aa
PF13855LRR_891-136 aa
PF14580LRR_994-182 aa
PF27087LRR_TMOD-LMOD94-139 aa
PF23598LRR_1495-155 aa
PF25013LRR_Zer-197-167 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G131120PF12799LRR_4811173.9e-30103.9
TkA07G131120PF00560LRR_181942.8e-2892.6
TkA07G131120PF23211LRR_LRWD1881626.5e-0626.7
TkA07G131120PF13855LRR_8911362e-2692.2
TkA07G131120PF14580LRR_9941828e-0523.0
TkA07G131120PF27087LRR_TMOD-LMOD941391.98.8
TkA07G131120PF23598LRR_14951551.9e-1867.1
TkA07G131120PF25013LRR_Zer-1971676.4e-0730.3
TkA07G131120PF23952LRR_EndoS971341.6e-0525.8
TkA07G131120PF25019LRR_R13L1-DRL21981330.0514.2
TkA07G131120PF13516LRR_61001131e-1454.0
TkA07G131120PF24048LRR_NXF1-51001672.4e-0524.7
TkA07G131120PF29594LRR_SKP21001860.002517.8
TkA07G131120PF12799LRR_41011373.9e-30103.9
TkA07G131120PF24758LRR_At5g563701011566.6e-0626.7
TkA07G131120PF00560LRR_11021232.8e-2892.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
C0LGK9Arabidopsis thalianasp|C0LGK9|Y2242_ARATH Probable LRR receptor-like serine/threonine-protein kinase At2g2423063.800%Swiss-ProtHigh
Q9LVN2Arabidopsis thalianasp|Q9LVN2|Y5815_ARATH Probably inactive leucine-rich repeat receptor-like protein kinase At5g5815052.900%Swiss-ProtHigh
Q9FK63Arabidopsis thalianasp|Q9FK63|CARLK_ARATH Calmodulin-binding receptor kinase CaMRLK38.600%Swiss-ProtLow
Q69JN6Oryza sativa subsp. japonicasp|Q69JN6|BRL1_ORYSJ Brassinosteroid LRR receptor kinase BRL138.500%Swiss-ProtLow
Q6ZCZ2Oryza sativa subsp. japonicasp|Q6ZCZ2|BRL3_ORYSJ Brassinosteroid LRR receptor kinase BRL334.200%Swiss-ProtMedium

JBrowse

View in Genome Browser