TkA07G129160 | RubberDandelionOmics

Gene overview

TkA07G129160

Reference: TK1151 Chr: Chr07 Coordinates: 33376516-33381831 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2767 bp · TkA07G129160|TK1151|cDNA

GAAGTAGGTTATTAACGTTTGAAGTTATTAATTTGGATTTTGGAACATGATAATAATGGCATTGGCATGGAGCGGATAAACTATCCCAATCTTCAAGGTGGAAGAGTTGATCCCTTGCTCTTATAAAACTTGAACTGCATCTTATCTTTAACATTAACACACACTGTTTAAATGGCAAGCTCATCAAACCCAACCCCTCCTTATATTTCATCACAAATACAAGACTTTAACTACATGTACGCATCAATCGCCAACGTCTC...

CDS

Download CDS FASTA

1326 bp · TkA07G129160|TK1151|CDS

ATGTTTACTGTAGCTGTACTGGTTGTGTTATCATGTCGTTATATTCCGGTGTGGATATACGAATCTATATGGGGTGATAATTCATCAGAAGATAATACCACGGACACAAGATGGGTTATAATTATGATACCTCTTGCTGTGTTTTTATCCATATGCTTGGTCATATTGATGGTTTGTTTCCTGTTCCTTATCCCCTATTTCGCCTTGTGGAAGGCTGCATCAAAACTAGTTGGACCCATAAAGCATATTGAGAAGAAGAA...

Protein

Download Protein FASTA

441 aa · TkA07G129160|TK1151|PROTEIN

MFTVAVLVVLSCRYIPVWIYESIWGDNSSEDNTTDTRWVIIMIPLAVFLSICLVILMVCFLFLIPYFALWKAASKLVGPIKHIEKKKKEREEGEKVLRLVCDEIDKLEFCGTHHPYYTGPILEAACQNADKIYDEILLRSPKAIECRNKSGYDIIQLAVLHRSDKIYTRVYDIWERKNLYRTIVDSSKNNILHLVGQLAPSHQLNRIPSAALQLQRELQWREEVKKLVFPTYITQENIFKETPDMVFTREHENLVKEGEK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G129160`
TK1151 ID	TkA07G129160
OH-1004 ID	LXL04_028202
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	91.700
Protein coverage (%)	TK1151 93.424 / OH-1004 50.490 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G129160`
Location	Chr07:33376516-33381831 (+)
Description	Protein of unknown function
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_028202` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0006457 protein folding Biological Process GO:0006654 phosphatidic acid biosynthetic process Biological Process GO:0007200 phospholipase C-activating G protein-coupled receptor signaling pathway Biological Process GO:0031571 mitotic G1 DNA damage checkpoint signaling Biological Process GO:0035556 intracellular signal transduction Biological Process GO:0046339 diacylglycerol metabolic process Biological Process GO:0046486 glycerolipid metabolic process Biological Process GO:0046580 negative regulation of Ras protein signal transduction Biological Process GO:0046834 lipid phosphorylation Biological Process GO:0050860 negative regulation of T cell receptor signaling pathway Biological Process GO:0070682 proteasome regulatory particle assembly Biological Process GO:0099562 maintenance of postsynaptic density structure Biological Process
KEGG gene cross-reference	ath:AT5G02620 ddi:DDB_G0287345 rno:81821 spo:2542919 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.876

Rank 1 · TkA07G129160 · TK1151

Cytoplasm0.077

Rank 2 · TkA07G129160 · TK1151

Endoplasmic reticulum0.074

Rank 3 · TkA07G129160 · TK1151

Lysosome / Vacuole0.032

Rank 4 · TkA07G129160 · TK1151

Nucleus0.024

Rank 5 · TkA07G129160 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29060VTC5_C14-62 aa

PF05620TMEM208_SND235-92 aa

PF05661DUF80839-95 aa

PF13962PGG43-58 aa

PF05661DUF808251-286 aa

PF13962PGG259-372 aa

PF29060VTC5_C305-399 aa

PF05661DUF808319-365 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G129160	`PF29060`	VTC5_C	14	62	1.1	10.0
TkA07G129160	`PF05620`	TMEM208_SND2	35	92	0.21	12.1
TkA07G129160	`PF05661`	DUF808	39	95	3.1	7.5
TkA07G129160	`PF13962`	PGG	43	58	1.2e-23	83.8
TkA07G129160	`PF05661`	DUF808	251	286	3.1	7.5
TkA07G129160	`PF13962`	PGG	259	372	1.2e-23	83.8
TkA07G129160	`PF29060`	VTC5_C	305	399	1.1	10.0
TkA07G129160	`PF05661`	DUF808	319	365	3.1	7.5
TkA07G129160	`PF05620`	TMEM208_SND2	321	329	0.21	12.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card