TkA07G107120 | RubberDandelionOmics

Gene overview

TkA07G107120

Reference: TK1151 Chr: Chr07 Coordinates: 27825806-27828527 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1513 bp · TkA07G107120|TK1151|cDNA

AAAAAAAGGTCAGGTTTAATTTTACTCCAATTCGATTCCTAAGGGGATTGATTCCTTGTGCGCGATCTGTTTGTGTGAATACAGAGAAGCGGAGATGATGAGGATGTTGCCTGATTGAAACTCAACGCCAGCTGTCCTGTTTGTCGGAGCTCGCCGCTTCCGACGCCGTTGTCTACTCCGTTAGCGGAAGTTGTTCCTCTCTCACAATACTCCGACGGCCATCACTAGATCTCGTCTTCTATTTCTACTATTTGTTCTCA...

CDS

Download CDS FASTA

399 bp · TkA07G107120|TK1151|CDS

ATGAATCATCAAGGTGTTATCTTGAATGGACGGTTTCTGTTGAAGATTATAGTGACAGATCATAAAGATTCTCGTTTATTAAGAGCATGTGCTAGAGAAGCTAACTACCACCACCTTCAAATCCTTATAAATGATTTCTCTATACCGAGTCAGACAGTCCAAATTAAAGTGTATGAAAGAGAGGCGTTCCAGATGCAAGAACAGGCTCGGGAAATTCGGGGAAAGAAAAGGAGTTATCAAGATCGTGTTAAGGATCTTGA...

Protein

Download Protein FASTA

132 aa · TkA07G107120|TK1151|PROTEIN

MNHQGVILNGRFLLKIIVTDHKDSRLLRACAREANYHHLQILINDFSIPSQTVQIKVYEREAFQMQEQAREIRGKKRSYQDRVKDLEDELQNAKMAEYRISIYGRKQSECDNLASWTVNCTNPLYIATNVSN

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G107120`
TK1151 ID	TkA07G107120
OH-1004 ID	LXL04_026855
Relationship / confidence	Multi Candidate From Tk1151 / Complex relationship
Protein identity (%)	100.000
Protein coverage (%)	TK1151 96.970 / OH-1004 78.528 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G107120

Location Chr07:27825806-27828527 (-)

Description Similar to SMC6B: Structural maintenance of chromosomes protein 6B

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g38280`	AMP deaminase plays a critical role in energy metabolism.	EMBRYONIC FACTOR 1 encodes an AMP deaminase and is essential for the zygote to embryo transition in Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2005.02411.x

Rice

Reference gene ID	Possible function	Papers / DOI
`Os07g0693500`	AMP deaminase plays a critical role in energy metabolism.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026855 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006188 IMP biosynthetic process Biological Process

GO:0006302 double-strand break repair Biological Process

GO:0007062 sister chromatid cohesion Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010165 response to X-ray Biological Process

GO:0032264 IMP salvage Biological Process

GO:0046033 AMP metabolic process Biological Process

GO:0005634 nucleus Cellular Component

GO:0005741 mitochondrial outer membrane Cellular Component

GO:0005783 endoplasmic reticulum Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT2G38280

ath:AT5G61460

dosa:Os07g0693500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.431

Rank 1 · TkA07G107120 · TK1151

Cytoplasm0.428

Rank 2 · TkA07G107120 · TK1151

Mitochondrion0.121

Rank 3 · TkA07G107120 · TK1151

Cell membrane0.083

Rank 4 · TkA07G107120 · TK1151

Endoplasmic reticulum0.050

Rank 5 · TkA07G107120 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF29363ENTR147-97 aa

PF10473CENP-F_leu_zip59-94 aa

PF28274INA17_C75-93 aa

PF19326AMP_deaminase79-119 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G107120	`PF29363`	ENTR1	47	97	0.13	12.7
TkA07G107120	`PF10473`	CENP-F_leu_zip	59	94	0.014	16.1
TkA07G107120	`PF28274`	INA17_C	75	93	0.13	12.6
TkA07G107120	`PF19326`	AMP_deaminase	79	119	7.6e-08	31.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O80452`	Arabidopsis thaliana	sp\|O80452\|AMPD_ARATH AMP deaminase	67.600%	Swiss-Prot	Low
`Q84NP7`	Oryza sativa subsp. japonica	sp\|Q84NP7\|AMPD_ORYSJ Probable AMP deaminase	57.800%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card