TkA07G094300 | RubberDandelionOmics

Gene overview

TkA07G094300

Reference: TK1151 Chr: Chr07 Coordinates: 24592753-24602699 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2209 bp · TkA07G094300|TK1151|cDNA

GTTTCCACGTTAAACATTTTCTTAAAATTCCCAAATCAGGATTCCCTTCAAACCACAACCGGGGAGATTACCAGATTCCAAAACCCCAAATTACAGGGAGATATTTGTGTGTTTCATCCTCTTCGTCTTCTCTAATTTCATCAAACTACTTGTTCATTCTTTCACTTCTCCTCCATTCATCTAAAATCCCAAAATTTTCATTATTTCCATACTCAAATCCTTCGGGAGGTCCCTAATTCCTTACAGCCTATGCCCACAAA...

CDS

Download CDS FASTA

1533 bp · TkA07G094300|TK1151|CDS

ATGAAAGGAGGCTACTTCTATGAACGCAGAACGAAGCAGCTATCTCTCTTCTTCTTCGCTGTTGTTTTTACAACCATTGTTGTTTGGTCTTGGGAGAAAACCCCTCTTCTCACATCCTTACTTCCATCTCACAGTCAAGTGATGCAGCTATTTCCAGCTGGTGAAGTAAAAGCAAAGCAAGTTACTCAACCAAAAGATGAAGTAGTTGCTAATCTAGAATCTCCAGTAACTTCTATAACCGCCCCCTCCACTTTAGGGGA...

Protein

Download Protein FASTA

510 aa · TkA07G094300|TK1151|PROTEIN

MKGGYFYERRTKQLSLFFFAVVFTTIVVWSWEKTPLLTSLLPSHSQVMQLFPAGEVKAKQVTQPKDEVVANLESPVTSITAPSTLGEKGLVDLVSPTTSSPINTPSFDIHEGEPSKTTQENHHVNTTNIAEQPVSSKTYINSNPPKQLIAPISPKKLDPEHIGAPPNVEKQACNYGKGKWIIDNNRPLYSGFGCKQWLSGMWACRLTQRTDFGYEKLKWHPQDCKMDDFTPLNFLKRMQDKTLAFIGDSLGRQQFQSLMC...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G094300`
TK1151 ID	TkA07G094300
OH-1004 ID	LXL04_027791
Relationship / confidence	Rbh Below Probable Coverage Or Synteny Threshold / Review
Protein identity (%)	98.300
Protein coverage (%)	TK1151 81.765 / OH-1004 58.033 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G094300

Location Chr07:24592753-24602699 (-)

Description Similar to TBL16: Protein trichome birefringence-like 16

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At2g05920`	Subtilisin-like protease SBT1.8.	No verified direct reference in this release
`At5g67360`	Serine protease.	Ara12 subtilisin-like protease from Arabidopsis thaliana: purification, substrate specificity and tissue localization.2003 · DOI: 10.1042/bj20021125 A subtilisin-like serine protease essential for mucilage release from Arabidopsis seed coats.2008 · DOI: 10.1111/j.1365-313x.2008.03437.x
`At5g20680`	May act as a bridging protein that binds pectin and other cell wall polysaccharides.	No verified direct reference in this release
`At3g14067`	Subtilisin-like protease SBT1.4.	No verified direct reference in this release
`At5g51750`	Subtilisin-like protease SBT1.3.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027791 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009834 plant-type secondary cell wall biogenesis Biological Process

GO:0010411 xyloglucan metabolic process Biological Process

GO:0045492 xylan biosynthetic process Biological Process

GO:0000138 Golgi trans cisterna Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005768 endosome Cellular Component

GO:0005794 Golgi apparatus Cellular Component

GO:0005802 trans-Golgi network Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0016020 membrane Cellular Component

GO:0008374 O-acyltransferase activity Molecular Function

GO:0016407 acetyltransferase activity Molecular Function

KEGG gene cross-reference

ath:AT2G37720

ath:AT3G62390

ath:AT4G23790

ath:AT5G20680

ath:AT5G64020

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.733

Rank 1 · TkA07G094300 · TK1151

Endoplasmic reticulum0.080

Rank 2 · TkA07G094300 · TK1151

Cell membrane0.073

Rank 3 · TkA07G094300 · TK1151

Extracellular0.061

Rank 4 · TkA07G094300 · TK1151

Cytoplasm0.038

Rank 5 · TkA07G094300 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF18341PSA_CBD125-147 aa

PF14416PMR5N172-225 aa

PF24536NXPE4_C219-264 aa

PF13839PC-Esterase228-508 aa

PF18341PSA_CBD346-374 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G094300	`PF18341`	PSA_CBD	125	147	0.058	14.0
TkA07G094300	`PF14416`	PMR5N	172	225	1.5e-13	51.6
TkA07G094300	`PF24536`	NXPE4_C	219	264	0.0049	17.2
TkA07G094300	`PF13839`	PC-Esterase	228	508	6.8e-70	237.0
TkA07G094300	`PF18341`	PSA_CBD	346	374	0.058	14.0

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9ZUF6`	Arabidopsis thaliana	sp\|Q9ZUF6\|SBT18_ARATH Subtilisin-like protease SBT1.8	65.800%	Swiss-Prot	High
`O65351`	Arabidopsis thaliana	sp\|O65351\|SBT17_ARATH Subtilisin-like protease SBT1.7	56.400%	Swiss-Prot	High
`F4K5L5`	Arabidopsis thaliana	sp\|F4K5L5\|TBL16_ARATH Protein trichome birefringence-like 16	46.500%	Swiss-Prot	Medium
`Q9LVJ1`	Arabidopsis thaliana	sp\|Q9LVJ1\|SBT14_ARATH Subtilisin-like protease SBT1.4	52.300%	Swiss-Prot	High
`Q9FLI4`	Arabidopsis thaliana	sp\|Q9FLI4\|SBT13_ARATH Subtilisin-like protease SBT1.3	51.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card