TkA07G085450 | RubberDandelionOmics

Gene overview

TkA07G085450

Reference: TK1151 Chr: Chr07 Coordinates: 22332237-22334708 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1107 bp · TkA07G085450|TK1151|cDNA

ATCAAACCTTGTAAATCCCTGCCCTGGTTCCCTGGCCTTTGGCAATGGCTCACACTATACTAAAAATTCCATTTCTCTCAACTATCACCACAGCTGCGGTTAAATTCTCCAAATCATCGCTTCATGGTAATGGCCGCCGTATCTGTCAATGTTCATCACCTCTATCCACTTCTCAAGTTCAACAACGACAACCGCAAATCAGAAGCCCTCAACTCGTCGCATTGGAGTATGCTGATCTTAGCATACCGCATATCGTGTGC...

CDS

Download CDS FASTA

879 bp · TkA07G085450|TK1151|CDS

ATGGCTCACACTATACTAAAAATTCCATTTCTCTCAACTATCACCACAGCTGCGGTTAAATTCTCCAAATCATCGCTTCATGGTAATGGCCGCCGTATCTGTCAATGTTCATCACCTCTATCCACTTCTCAAGTTCAACAACGACAACCGCAAATCAGAAGCCCTCAACTCGTCGCATTGGAGTATGCTGATCTTAGCATACCGCATATCGTGTGCGAGGAGTTGGGTGCTACTAGGGTGAGGCAGCATGTTAACCCTCT...

Protein

Download Protein FASTA

292 aa · TkA07G085450|TK1151|PROTEIN

MAHTILKIPFLSTITTAAVKFSKSSLHGNGRRICQCSSPLSTSQVQQRQPQIRSPQLVALEYADLSIPHIVCEELGATRVRQHVNPLSSTLSFPVEVPDWNDVFEDPNLPLVVDIGSGSGRFVMWLAKRNHGSKNYMGLEIRKKLVTRAEKWAKELALNNIHFVFANATISFKELISTYPGPLMLVSILCPDPHFKKRHHKRRIIQKPLVEAITDTLMPGGHVFIQSDVLEVAIDMRNYFDAESAKLVFESDLESDNEGW...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G085450`
TK1151 ID	TkA07G085450
OH-1004 ID	LXL04_027685
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID	`TkA07G085450`
Location	Chr07:22332237-22334708 (+)
Description	Similar to trmB: tRNA (guanine-N(7)-)-methyltransferase (Synechocystis sp. (strain PCC 6803 / Kazusa)
Arabidopsis / Rice Reference Genes and Papers	Download references for this gene Arabidopsis No hit for this species in the current source table. Rice No hit for this species in the current source table.
Functional annotation source	View annotation sources Functional annotation source: OH1004 · `LXL04_027685` · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.
GO annotations (OH1004 source)	GO:0030488 tRNA methylation Biological Process GO:0036265 RNA (guanine-N7)-methylation Biological Process GO:0043527 tRNA methyltransferase complex Cellular Component GO:0008176 tRNA (guanine(46)-N7)-methyltransferase activity Molecular Function
KEGG gene cross-reference	cya:CYA_2671 cyb:CYB_2166 syc:syc1155_d syf:Synpcc7942_0358 syn:sll1300 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.832

Rank 1 · TkA07G085450 · TK1151

Mitochondrion0.121

Rank 2 · TkA07G085450 · TK1151

Cytoplasm0.102

Rank 3 · TkA07G085450 · TK1151

Nucleus0.080

Rank 4 · TkA07G085450 · TK1151

Peroxisome0.042

Rank 5 · TkA07G085450 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF05175MTS16-31 aa

PF13679Methyltransf_32107-170 aa

PF02390Methyltransf_4110-285 aa

PF24675NpmA111-168 aa

PF30636Methyltransf_37111-175 aa

PF13847Methyltransf_31112-169 aa

PF13649Methyltransf_25112-168 aa

PF01135PCMT112-173 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G085450	`PF05175`	MTS	16	31	0.013	15.8
TkA07G085450	`PF13679`	Methyltransf_32	107	170	0.0014	19.4
TkA07G085450	`PF02390`	Methyltransf_4	110	285	4.9e-35	121.3
TkA07G085450	`PF24675`	NpmA	111	168	0.069	13.2
TkA07G085450	`PF30636`	Methyltransf_37	111	175	0.089	13.5
TkA07G085450	`PF13847`	Methyltransf_31	112	169	1.9e-07	31.7
TkA07G085450	`PF13649`	Methyltransf_25	112	168	1.6e-06	29.5
TkA07G085450	`PF01135`	PCMT	112	173	0.0046	17.5
TkA07G085450	`PF05175`	MTS	112	225	0.013	15.8
TkA07G085450	`PF01209`	Ubie_methyltran	112	169	0.025	14.6
TkA07G085450	`PF13489`	Methyltransf_23	112	164	0.047	14.1
TkA07G085450	`PF08123`	DOT1	112	172	0.05	13.9
TkA07G085450	`PF00398`	RrnaAD	112	151	0.28	11.0
TkA07G085450	`PF08241`	Methyltransf_11	113	169	7e-05	24.1
TkA07G085450	`PF08242`	Methyltransf_12	113	170	0.00099	20.5
TkA07G085450	`PF29244`	Methyltransf_ANTKMT	114	165	0.00011	23.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

No result was found for this query.

JBrowse

View in Genome Browser

Gene Card