TkA07G081520 | RubberDandelionOmics

Gene overview

TkA07G081520

Reference: TK1151 Chr: Chr07 Coordinates: 21299467-21307224 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3862 bp · TkA07G081520|TK1151|cDNA

AAAACGTTTAATTTATTTTTTACCACAAGGGAGAATAGTTGTTGAATACAGATACGGCGGTGACTTGATCTACTTCATATGTGTCACCGTTCAACATATACCTTCGTCTCTCTCTCTCTCTCCCACACAAAAACCTTCGCTCGGTCCACTCTCGCTTTTCACATTTTATCGACAGAAACAGAGATCCAAGGAGTTGGAACTTGGAACAAGTCTCCCTGCATTTCGATTCACACTTCTCGCATTGAAGTTTCACTGCAACA...

CDS

Download CDS FASTA

3291 bp · TkA07G081520|TK1151|CDS

ATGGAAGAGGAAAATGAAGTGGAGCTTTTACAAAGGTACAGGCGAGATAGGCGGATACTTCTTAATTACTTACTATCTGGTAGTTTGATTAAGAAAGTTGTGATGCCACCTGGTGCTGTGTCGTTGGATGATGTGGATCTAGATCAAGTTAGTGTTGATTTTGTGCTAAATTCCGTGAAAAAAGGTGACATGCTTGAGCTCTCAGAAGCTATTAGAGAATATCATGATAGTACTGGATACCCTCATATGACTGCAGAGTC...

Protein

Download Protein FASTA

1096 aa · TkA07G081520|TK1151|PROTEIN

MEEENEVELLQRYRRDRRILLNYLLSGSLIKKVVMPPGAVSLDDVDLDQVSVDFVLNSVKKGDMLELSEAIREYHDSTGYPHMTAESEGEFFLATNPDSSGSPPKRAPPAVPFVAASPIVSDIASLPFEATEEDEPTISNSKSFNSGQPQNLTVDDIDDFEDDDDLEELNSRRYSRRTMNDTADLIVGLPPFATGITDDDLRETAYEILLAAAGASGGLIVPSKGKKKEKKSGLLKKLGRSKSEQVTMQSQQSTGLTGLL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G081520`
TK1151 ID	TkA07G081520
OH-1004 ID	LXL04_027631
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	99.800
Protein coverage (%)	TK1151 99.909 / OH-1004 73.391 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G081520

Location Chr07:21299467-21307224 (+)

Description Similar to PATROL1: Protein unc-13 homolog

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g06970`	Controls the tethering of the proton ATPase AHA1 to the plasma membrane.	A Munc13-like protein in Arabidopsis mediates H+-ATPase translocation that is essential for stomatal responses.2013 · DOI: 10.1038/ncomms3215

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027631 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006886 intracellular protein transport Biological Process

GO:0006952 defense response Biological Process

GO:0009555 pollen development Biological Process

GO:0009611 response to wounding Biological Process

GO:0009651 response to salt stress Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0010118 stomatal movement Biological Process

GO:0043547 positive regulation of GTPase activity Biological Process

GO:0072659 protein localization to plasma membrane Biological Process

GO:1900426 positive regulation of defense response to bacterium Biological Process

GO:1901002 positive regulation of response to salt stress Biological Process

GO:0000325 plant-type vacuole Cellular Component

KEGG gene cross-reference

ath:AT3G07940

ath:AT4G05330

ath:AT4G21160

ath:AT5G06970

dosa:Os02g0327000

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.415

Rank 1 · TkA07G081520 · TK1151

Cytoplasm0.373

Rank 2 · TkA07G081520 · TK1151

Nucleus0.218

Rank 3 · TkA07G081520 · TK1151

Golgi apparatus0.150

Rank 4 · TkA07G081520 · TK1151

Endoplasmic reticulum0.103

Rank 5 · TkA07G081520 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF27630UNC13_N9-77 aa

PF27629UNC13_3rd451-568 aa

PF06292MUN530-592 aa

PF11433DUF3198575-600 aa

PF15923DUF4745576-632 aa

PF06292MUN619-845 aa

PF27629UNC13_3rd704-734 aa

PF25761TPR_PATROL1712-1094 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G081520	`PF27630`	UNC13_N	9	77	4.3e-30	104.0
TkA07G081520	`PF27629`	UNC13_3rd	451	568	1.1e-42	145.7
TkA07G081520	`PF06292`	MUN	530	592	0.024	14.4
TkA07G081520	`PF11433`	DUF3198	575	600	0.066	13.8
TkA07G081520	`PF15923`	DUF4745	576	632	0.21	12.3
TkA07G081520	`PF06292`	MUN	619	845	0.024	14.4
TkA07G081520	`PF27629`	UNC13_3rd	704	734	1.1e-42	145.7
TkA07G081520	`PF25761`	TPR_PATROL1	712	1094	2.4e-129	432.6
TkA07G081520	`PF17670`	DUF5530	1009	1083	0.082	13.4

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8RX56`	Arabidopsis thaliana	sp\|Q8RX56\|UNC13_ARATH Protein unc-13 homolog	67.100%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card