RubberDandelionOmics Rubber Dandelion Multi-omics Website
More
Transcriptome Expression Annotation Rubber Pathway TF Prediction Targets Protein Network Resequencing Tools Downloads
ZH EN

How to use this page

Gene Card

Enter a TK1151 or OH-1004 gene ID to view sequences, annotations and analyses in the corresponding reference genome.
Flanking length, max 10000 bp
Examples TkA01G624900 LXL04_000258

Gene overview

TkA07G080480
Reference: TK1151 Chr: Chr07 Coordinates: 21039454-21042755 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

Download cDNA FASTA

1536 bp · TkA07G080480|TK1151|cDNA

AACTTTAAATGGCATCTTTTGCCCCTTTATTATCTTCCATGTCCCTGCTTTTTTTTCCAAGACTTATTGAAGTCAGTTCTTTAGATTTTTACCTTTTTAATGTACCACATTTGGCCAATCATCATACAAAAAGTGGAAGAATTCATATGCAATTATGCAAATGCTAAACTTTACCAAGTCAAGAACTCGGTCAAACAGACCTGGTTCTTTAGGAGGCATGGATTTTATAGATCCAGTGAAGAAAAGTGGTGTTGTAAGAA...

CDS

Download CDS FASTA

1236 bp · TkA07G080480|TK1151|CDS

ATGCAAATGCTAAACTTTACCAAGTCAAGAACTCGGTCAAACAGACCTGGTTCTTTAGGAGGCATGGATTTTATAGATCCAGTGAAGAAAAGTGGTGTTGTAAGAAAGATTATATTTGCTACAAGTCTTGTAGCTTTATGCATCACAATGATCAAATTATCCCCATCTTTCAGCAGCCCTAGCCCTTTCTCTCGTCATGAAACAGGGATTACTCACGTGTTAGTAACAGGAGGAGCTGGTTTTATTGGCTCACATGCTTC...

Protein

Download Protein FASTA

411 aa · TkA07G080480|TK1151|PROTEIN

MQMLNFTKSRTRSNRPGSLGGMDFIDPVKKSGVVRKIIFATSLVALCITMIKLSPSFSSPSPFSRHETGITHVLVTGGAGFIGSHASLRLLKDSHRVTIVDNLSRGNLGAIKVLQSLFPEPGRLQFIYADLGDPKAVNKIFSENAFDAVMHFAAVAYVGESTLDPLRYYHNITSNTLVVLEAMAAHNVNTLIYSSTCATYGEPDKMPITEETPQHPINPYGKAKKMAEDIILDFHKNSDMAVMILRYFNVIGSDPDGRLG...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

Download Gene (CDS) Download Protein

ID Mapping

Input IDTkA07G080480
TK1151 IDTkA07G080480
OH-1004 IDLXL04_027627
Relationship / confidenceMulti Source To Oh1004 / Complex relationship
Protein identity (%)99.300
Protein coverage (%)TK1151 100.000 / OH-1004 99.757
Coverage and evidence

Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.

Source versionTK1151 / GWHBCHF00000000
Open Full ID Mapping
SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene IDTkA07G080480
LocationChr07:21039454-21042755 (-)
DescriptionSimilar to MUR4: UDP-arabinose 4-epimerase 1
Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene IDPossible functionPapers / DOI
At4g20460 Probable UDP-arabinose 4-epimerase 3. No verified direct reference in this release
At1g30620 Acts as a UDP-D-xylose 4-epimerase but lacks both UDP-D- glucose and UDP-D-glucuronic acid 4-epimerase activities in vitro.
The biosynthesis of L-arabinose in plants: molecular cloning and characterization of a Golgi-localized UDP-D-xylose 4-epimerase encoded by the MUR4 gene of Arabidopsis.2003 · DOI: 10.1105/tpc.008425
At2g34850 Putative UDP-arabinose 4-epimerase 2. No verified direct reference in this release

Rice

Reference gene IDPossible functionPapers / DOI
Os04g0618200 Probable UDP-arabinose 4-epimerase 2. No verified direct reference in this release
Os07g0139400 Probable UDP-arabinose 4-epimerase 1. No verified direct reference in this release
Functional annotation source
View annotation sources

Functional annotation source: OH1004 · LXL04_027627 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)
GO:0006012 galactose metabolic process Biological Process
GO:0009793 embryo development ending in seed dormancy Biological Process
GO:0009832 plant-type cell wall biogenesis Biological Process
GO:0019567 arabinose biosynthetic process Biological Process
GO:0033358 UDP-L-arabinose biosynthetic process Biological Process
GO:0045227 capsule polysaccharide biosynthetic process Biological Process
GO:0048868 pollen tube development Biological Process
GO:0000138 Golgi trans cisterna Cellular Component
GO:0005794 Golgi apparatus Cellular Component
GO:0032580 Golgi cisterna membrane Cellular Component
GO:0003978 UDP-glucose 4-epimerase activity Molecular Function
GO:0050373 UDP-arabinose 4-epimerase activity Molecular Function
KEGG gene cross-reference
ath:AT1G30620
ath:AT2G34850
ath:AT4G20460
dosa:Os07g0139400
These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.
Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene
Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Golgi apparatus0.467
Rank 1 · TkA07G080480 · TK1151
Endoplasmic reticulum0.214
Rank 2 · TkA07G080480 · TK1151
Lysosome / Vacuole0.158
Rank 3 · TkA07G080480 · TK1151
Cytoplasm0.106
Rank 4 · TkA07G080480 · TK1151
Extracellular0.073
Rank 5 · TkA07G080480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04321RmlD_sub_bind72-250 aa
PF00106adh_short72-143 aa
PF01370Epimerase73-334 aa
PF02719Polysacc_synt_273-253 aa
PF08659KR73-155 aa
PF16363GDP_Man_Dehyd74-389 aa
PF010733Beta_HSD74-235 aa
PF07993NAD_binding_475-255 aa
Gene IDDomain IDDomain NameStart aaEnd aaE-valueScore
TkA07G080480PF04321RmlD_sub_bind722504.6e-1246.3
TkA07G080480PF00106adh_short721430.007916.4
TkA07G080480PF01370Epimerase733343.7e-53181.1
TkA07G080480PF02719Polysacc_synt_2732532.1e-1350.8
TkA07G080480PF08659KR731550.1712.5
TkA07G080480PF16363GDP_Man_Dehyd743892e-54186.0
TkA07G080480PF010733Beta_HSD742353.4e-1556.6
TkA07G080480PF07993NAD_binding_4752551.1e-0732.0
TkA07G080480PF13460NAD_binding_10772494.6e-0833.9
TkA07G080480PF13649Methyltransf_25891610.1813.3
TkA07G080480PF010733Beta_HSD2833223.4e-1556.6
TkA07G080480PF02719Polysacc_synt_23023352.1e-1350.8
TkA07G080480PF13460NAD_binding_103193514.6e-0833.9
TkA07G080480PF13649Methyltransf_253313570.1813.3

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

ProteinOrganismDescriptionIdentityDatabaseConfidence
Q9SUN3Arabidopsis thalianasp|Q9SUN3|ARAE3_ARATH Probable UDP-arabinose 4-epimerase 379.500%Swiss-ProtHigh
Q9SA77Arabidopsis thalianasp|Q9SA77|ARAE1_ARATH UDP-arabinose 4-epimerase 179.000%Swiss-ProtHigh
O64749Arabidopsis thalianasp|O64749|ARAE2_ARATH Putative UDP-arabinose 4-epimerase 277.100%Swiss-ProtHigh
Q8H0B6Oryza sativa subsp. japonicasp|Q8H0B6|ARAE2_ORYSJ Probable UDP-arabinose 4-epimerase 281.500%Swiss-ProtHigh
Q8H930Oryza sativa subsp. japonicasp|Q8H930|ARAE1_ORYSJ Probable UDP-arabinose 4-epimerase 177.100%Swiss-ProtHigh

JBrowse

View in Genome Browser