TkA07G078980 | RubberDandelionOmics

Gene overview

TkA07G078980

Reference: TK1151 Chr: Chr07 Coordinates: 20610343-20616569 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4235 bp · TkA07G078980|TK1151|cDNA

AAAAAAACTGACTCGAACCGAATTTAACTGAACCATCATACAAAGTTATGCAAATTAAAAAGAGAGACAAATTTGTTGCCACAAATATCAAATTTGGCCTTCAATAGACTCCTCTTTTGTGAGGATAGAAGTCGCCCCCTCAATTTTCATCTCTGCAACTCTCCTTCACAAGCAACAATGGAAGCTTCATCAATCATATGTGCTTCCGCTCCATTACAAGTCAAGTCTAAGTCCCCCTTCTCTTCGTCTTCGCACAAATC...

CDS

Download CDS FASTA

3756 bp · TkA07G078980|TK1151|CDS

ATGGAAGCTTCATCAATCATATGTGCTTCCGCTCCATTACAAGTCAAGTCTAAGTCCCCCTTCTCTTCGTCTTCGCACAAATCCAGTTATGTGGTACACAATCGTAACCTATCGAGTAAGAACAAAAAGACTGTTACTTTGCGGTGTTTCCATACACAAGGCCGTCGGGCGGCCCCCCCTGCGCCTCGTTACTTCACTTCTAAGATTGTTGGCGATAGATTAACTTCTCCATTGGACAAACCATTGATTCAAAGGCCATT...

Protein

Download Protein FASTA

1251 aa · TkA07G078980|TK1151|PROTEIN

MEASSIICASAPLQVKSKSPFSSSSHKSSYVVHNRNLSSKNKKTVTLRCFHTQGRRAAPPAPRYFTSKIVGDRLTSPLDKPLIQRPLLDQCTRFSCFHHGRRKRTPICKFSSRMLSDKSVFHISKQGVNNASEKRVQVACTAVGPDEPHAAASTAWPEGALEQQSSSDLLYDTESSEWRRELEAFLGSELPSHPKLYRGKLENGLRYLILPNKVPQTRFEAHMEVHVGSIDEEDDEQGIAHMIEHVAFLGSKKREKLLRT...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G078980`
TK1151 ID	TkA07G078980
OH-1004 ID	LXL04_027618
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.400
Protein coverage (%)	TK1151 100.000 / OH-1004 96.169 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G078980

Location Chr07:20610343-20616569 (-)

Description Similar to SPP: Stromal processing peptidase, chloroplastic

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g42390`	Cleaves presequences (transit peptides) from chloroplastic protein precursors.	No verified direct reference in this release

Rice

Reference gene ID	Possible function	Papers / DOI
`Os06g0625400`	Cleaves presequences (transit peptides) from chloroplastic protein precursors.	No verified direct reference in this release
`UniProt: B8B0E2`	Cleaves presequences (transit peptides) from chloroplastic protein precursors.	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027618 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006508 proteolysis Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0016485 protein processing Biological Process

GO:0005739 mitochondrion Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009507 chloroplast Cellular Component

GO:0009536 plastid Cellular Component

GO:0009570 chloroplast stroma Cellular Component

GO:0003729 mRNA binding Molecular Function

GO:0004222 metalloendopeptidase activity Molecular Function

GO:0008233 peptidase activity Molecular Function

GO:0008237 metallopeptidase activity Molecular Function

KEGG gene cross-reference

ath:AT5G42390

dosa:Os06g0625400

ecj:JW1489

eco:b1494

osa:4341569

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Plastid0.878

Rank 1 · TkA07G078980 · TK1151

Mitochondrion0.137

Rank 2 · TkA07G078980 · TK1151

Nucleus0.040

Rank 3 · TkA07G078980 · TK1151

Cytoplasm0.037

Rank 4 · TkA07G078980 · TK1151

Cell membrane0.014

Rank 5 · TkA07G078980 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00675Peptidase_M16210-330 aa

PF05193Peptidase_M16_C362-595 aa

PF00675Peptidase_M16787-894 aa

PF05193Peptidase_M16_C926-1145 aa

PF22456PqqF-like_C_41065-1155 aa

PF00675Peptidase_M161108-1146 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G078980	`PF00675`	Peptidase_M16	210	330	9.5e-22	78.2
TkA07G078980	`PF05193`	Peptidase_M16_C	362	595	2e-39	136.1
TkA07G078980	`PF00675`	Peptidase_M16	787	894	9.5e-22	78.2
TkA07G078980	`PF05193`	Peptidase_M16_C	926	1145	2e-39	136.1
TkA07G078980	`PF22456`	PqqF-like_C_4	1065	1155	0.023	15.6
TkA07G078980	`PF00675`	Peptidase_M16	1108	1146	9.5e-22	78.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FIH8`	Arabidopsis thaliana	sp\|Q9FIH8\|SPP_ARATH Stromal processing peptidase, chloroplastic	73.200%	Swiss-Prot	High
`Q69TY5`	Oryza sativa subsp. japonica	sp\|Q69TY5\|SPP_ORYSJ Stromal processing peptidase, chloroplastic	69.100%	Swiss-Prot	High
`B8B0E2`	Oryza sativa subsp. indica	sp\|B8B0E2\|SPP_ORYSI Stromal processing peptidase, chloroplastic	69.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card