TkA07G078970 | RubberDandelionOmics

Gene overview

TkA07G078970

Reference: TK1151 Chr: Chr07 Coordinates: 20602750-20609002 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

4331 bp · TkA07G078970|TK1151|cDNA

CGACATACTCAAACTTAAGGGACCTAAAGCATCAATATATCAAACTTCTGTGCAAAAAGTTGTTAAAAAACGAACAAAGTGTCCAAACGTTCAAAATCTACAACCTACTAAACCCTAACATAAAACCCTTCTTCATCCCCACCGTAAGCGATTTGCAGTGGTCACCAGCTCAATAACGACGACTAAGCACCATGAAGTCCGAAGCAGCAGCAAAGGTTTCAGGGAGGCATAGAATGACGCCGCACCTACCCAACAATCCC...

CDS

Download CDS FASTA

3153 bp · TkA07G078970|TK1151|CDS

ATGTTAAAGTCAAAACTTTGTCATCTTAAAGGTGCCGACCATCAAAAGTTAGTGTCTTGTAAAGAAGAACCATCAGAAATGGGCGGATACTTCATATTAAATGGACTTGAAAGAGTTGTGAGGCTATTAGTCGTACCAAAAAGAAACTATCCAACTAGTATGGAGAGAAGTGCATTTAAAAACAGAAGAGAAGGGTTCACTGATAAAGCTGTGGTGATAAGATGTGTTAGAGAAGACCAATCAGCTGTGACCGTTAACTT...

Protein

Download Protein FASTA

1050 aa · TkA07G078970|TK1151|PROTEIN

MLKSKLCHLKGADHQKLVSCKEEPSEMGGYFILNGLERVVRLLVVPKRNYPTSMERSAFKNRREGFTDKAVVIRCVREDQSAVTVNLYYISNGSARVGFRIRGRENLLPIGLVLKALIDTTDHEIFMSLSSVYNEKYEKAMGSVGTQIMSERAKIILNEVRDLSLFTRVQCLQYIGEYFKPFMDGMENESHSAVADAVLREFVLVHLDNNHDKFNLLIFMVQKLFSFIDQTSIPDNPDSLQTQEVLLPGQLVTIYIKEKL...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G078970`
TK1151 ID	TkA07G078970
OH-1004 ID	LXL04_027617
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.200
Protein coverage (%)	TK1151 100.000 / OH-1004 85.831 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G078970

Location Chr07:20602750-20609002 (+)

Description Similar to NRPA2: DNA-directed RNA polymerase I subunit 2

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g29940`	DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027617 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006361 transcription initiation at RNA polymerase I promoter Biological Process

GO:0006362 transcription elongation by RNA polymerase I Biological Process

GO:0006363 termination of RNA polymerase I transcription Biological Process

GO:0009303 rRNA transcription Biological Process

GO:0009561 megagametogenesis Biological Process

GO:0017126 nucleologenesis Biological Process

GO:0042254 ribosome biogenesis Biological Process

GO:0042790 nucleolar large rRNA transcription by RNA polymerase I Biological Process

GO:0001650 fibrillar center Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005654 nucleoplasm Cellular Component

KEGG gene cross-reference

ath:AT1G29940

hsa:84172

mmu:20017

pon:100171727

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.941

Rank 1 · TkA07G078970 · TK1151

Cytoplasm0.067

Rank 2 · TkA07G078970 · TK1151

Mitochondrion0.024

Rank 3 · TkA07G078970 · TK1151

Cell membrane0.020

Rank 4 · TkA07G078970 · TK1151

Endoplasmic reticulum0.012

Rank 5 · TkA07G078970 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF04563RNA_pol_Rpb2_11-279 aa

PF04561RNA_pol_Rpb2_268-245 aa

PF04560RNA_pol_Rpb2_7146-169 aa

PF04565RNA_pol_Rpb2_3333-396 aa

PF06883RNA_pol_Rpa2_4450-507 aa

PF04565RNA_pol_Rpb2_3534-546 aa

PF00562RNA_pol_Rpb2_6565-933 aa

PF28508UBA_SDE5627-651 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G078970	`PF04563`	RNA_pol_Rpb2_1	1	279	4.6e-15	56.4
TkA07G078970	`PF04561`	RNA_pol_Rpb2_2	68	245	1e-11	45.6
TkA07G078970	`PF04560`	RNA_pol_Rpb2_7	146	169	1.9e-21	77.0
TkA07G078970	`PF04565`	RNA_pol_Rpb2_3	333	396	5.1e-27	94.5
TkA07G078970	`PF06883`	RNA_pol_Rpa2_4	450	507	9.2e-19	67.8
TkA07G078970	`PF04565`	RNA_pol_Rpb2_3	534	546	5.1e-27	94.5
TkA07G078970	`PF00562`	RNA_pol_Rpb2_6	565	933	3.8e-121	405.5
TkA07G078970	`PF28508`	UBA_SDE5	627	651	0.25	12.1
TkA07G078970	`PF13248`	Zn_ribbon_3	711	722	0.85	9.9
TkA07G078970	`PF04560`	RNA_pol_Rpb2_7	935	1043	1.9e-21	77.0
TkA07G078970	`PF13248`	Zn_ribbon_3	972	983	0.85	9.9
TkA07G078970	`PF13248`	Zn_ribbon_3	1005	1013	0.85	9.9

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`F4I366`	Arabidopsis thaliana	sp\|F4I366\|NRPA2_ARATH DNA-directed RNA polymerase I subunit 2	69.000%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card