Gene Card
Gene overview
cDNA / CDS / Protein Sequences
708 bp · TkA07G053570|TK1151|cDNA
ATGCCTGGGTTTGAACCCAGAACCTCCCATCTAAAATGCAATGTCTCTACCAGGGTGATAATGTATGCACTTGATTTGAACTTCTCTTCCATCCAAAGTCTACAAACCTCTATAGACTCCCTTTCGAAGACCCTCTCTACTGACACATTGAAATCAAGCGGTCCCGATTTTGGTGCAGCGCCTTTTAAGTTCTTCACCTCATGGCTTGCGGACCCCAATTGCGAGAAAGTGGTTGAAGACAGCTGGTGCAAAGACGGCCC...
708 bp · TkA07G053570|TK1151|CDS
ATGCCTGGGTTTGAACCCAGAACCTCCCATCTAAAATGCAATGTCTCTACCAGGGTGATAATGTATGCACTTGATTTGAACTTCTCTTCCATCCAAAGTCTACAAACCTCTATAGACTCCCTTTCGAAGACCCTCTCTACTGACACATTGAAATCAAGCGGTCCCGATTTTGGTGCAGCGCCTTTTAAGTTCTTCACCTCATGGCTTGCGGACCCCAATTGCGAGAAAGTGGTTGAAGACAGCTGGTGCAAAGACGGCCC...
Protein
Download Protein FASTA235 aa · TkA07G053570|TK1151|PROTEIN
MPGFEPRTSHLKCNVSTRVIMYALDLNFSSIQSLQTSIDSLSKTLSTDTLKSSGPDFGAAPFKFFTSWLADPNCEKVVEDSWCKDGPNLSLHSKTERLARKLRILKEDLKKWRKQEIRIRTEESDHLVKRIAEIDIIAEVLPLDDQAIKDRNDAIIKLQENEAARVQDLSQKSRCKWLLDGDENSSFIHGLINSNSKRNRISGLNKDGIWLADPGSIKRECLRFFQDKYRDPCPI
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G053570 |
|---|---|
| TK1151 ID | TkA07G053570 |
| OH-1004 ID | LXL04_000694 |
| Relationship / confidence | Multi Source To Oh1004 / Complex relationship |
| Protein identity (%) | 76.900 |
| Protein coverage (%) | TK1151 79.149 / OH-1004 9.389Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G053570 |
|---|---|
| Location | Chr07:14308953-14310438 (-) |
| Description | Similar to LBD13: LOB domain-containing protein 13 |
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene ArabidopsisNo hit for this species in the current source table. RiceNo hit for this species in the current source table. |
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · |
| GO annotations (OH1004 source) | GO:0006355 regulation of DNA-templated transcription Biological Process GO:0009965 leaf morphogenesis Biological Process GO:0010016 shoot system morphogenesis Biological Process GO:0010311 lateral root formation Biological Process GO:0010628 positive regulation of gene expression Biological Process GO:0045893 positive regulation of DNA-templated transcription Biological Process GO:1905177 tracheary element differentiation Biological Process GO:0005634 nucleus Cellular Component GO:0000976 transcription cis-regulatory region binding Molecular Function GO:0001216 DNA-binding transcription activator activity Molecular Function GO:0003677 DNA binding Molecular Function GO:0003824 catalytic activity Molecular Function |
| KEGG gene cross-reference | ath:AT2G30130 ath:AT2G30340 ath:AT2G40470 ath:AT3G27650 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF25566RIMB1_N88-153 aaPF30676CCDC186_middle90-171 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G053570 | PF25566 | RIMB1_N | 88 | 153 | 0.043 | 14.4 |
| TkA07G053570 | PF30676 | CCDC186_middle | 90 | 171 | 0.013 | 15.9 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.
No result was found for this query.