TkA07G053480 | RubberDandelionOmics

Gene overview

TkA07G053480

Reference: TK1151 Chr: Chr07 Coordinates: 14266233-14275531 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3624 bp · TkA07G053480|TK1151|cDNA

AGAAAATGTTAGAGATAAAAGGATAGAATTTGATCTATTCCCTCGATTCTTGTAAAAATAGTGTAAATTGTAAAATTTGTACTATTTATTTTCCAAATAAGAATTATATATTTCTATGCATCAATACGTGGCCAAAATAGCACTCTCACCAACACCAATTTGGAGTAATACATTACGCATTAAAACCTGTACATTTATCCGGTCACCTGTCATCTATGCCGATAGGGTGGACAAATCCCATCTGCAAGACTGCAACTCTA...

CDS

Download CDS FASTA

2931 bp · TkA07G053480|TK1151|CDS

ATGATGCAGCCGGAGATGCCGATTTGTAATACTTGTGGCGAGCAAGTAGGGTTTGGGTCTAATGGGAGTGGAGTGTTTGTCGGCTGCCATGAGTGTAATTTCCCGATCTGTAAAGCTTGTTTGGATTATGAGATCAAGGAAGGTCACAATGCTTGCATACAATGCGGTACCCCTTACGAAGTAAGCTTGACAAATCTGGCAGAAAAGGAGCCTGTCACCCGCTCTACCATGGCTGGTCACCTTAATCACAGTCAGGATGC...

Protein

Download Protein FASTA

976 aa · TkA07G053480|TK1151|PROTEIN

MMQPEMPICNTCGEQVGFGSNGSGVFVGCHECNFPICKACLDYEIKEGHNACIQCGTPYEVSLTNLAEKEPVTRSTMAGHLNHSQDAGLHARNISTVSTVDSEMIDEDGNPIWKNRVESWKDKKNKKKKGVAKAPKEVQIPIDQHMGEKQGSTETNTIQPLSQIVPIPKSQITPYRIVIIVRLIILGLFFHYRITNPVESSYGLWLTSVICEIWFAISWVLDQFPKWYPINRVTFTDELSSRYEREGEPSELAAVDFFVS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G053480`
TK1151 ID	TkA07G053480
OH-1004 ID	LXL04_027374
Relationship / confidence	Multi Source To Oh1004 / Complex relationship
Protein identity (%)	96.100
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G053480

Location Chr07:14266233-14275531 (-)

Description Similar to CESA8: Cellulose synthase A catalytic subunit 8 [UDP-forming]

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g18780`	Catalytic subunit of cellulose synthase terminal complexes ('rosettes'), required for beta-1,4-glucan microfibril crystallization, a major mechanism of the cell wall formation.	Multiple cellulose synthase catalytic subunits are required for cellulose synthesis in Arabidopsis.2000 · DOI: 10.1105/tpc.12.12.2529 Disruption of the cellulose synthase gene, AtCesA8/IRX1, enhances drought and osmotic stress tolerance in Arabidopsis.2005 · DOI: 10.1111/j.1365-313x.2005.02452.x Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance.2007 · DOI: 10.1105/tpc.106.048058
`At5g44030`	Catalytic subunit of cellulose synthase terminal complexes ('rosettes'), required for beta-1,4-glucan microfibril crystallization, a major mechanism of the cell wall formation.	Impairment of cellulose synthases required for Arabidopsis secondary cell wall formation enhances disease resistance.2007 · DOI: 10.1105/tpc.106.048058

Rice

Reference gene ID	Possible function	Papers / DOI
`UniProt: A2WV32`	Catalytic subunit of cellulose synthase terminal complexes ('rosettes'), required for beta-1,4-glucan microfibril crystallization, a major mechanism of the cell wall formation (By similarity).	No verified direct reference in this release
`Os01g0750300`	Catalytic subunit of cellulose synthase terminal complexes ('rosettes'), required for beta-1,4-glucan microfibril crystallization, a major mechanism of the cell wall formation (By similarity).	Three distinct rice cellulose synthase catalytic subunit genes required for cellulose synthesis in the secondary wall.2003 · DOI: 10.1104/pp.103.022442 Fine mapping and isolation of Bc7(t), allelic to OsCesA4.2007 · DOI: 10.1016/s1673-8527(07)60115-5
`UniProt: A2Z1C8`	Catalytic subunit of cellulose synthase terminal complexes ('rosettes'), required for beta-1,4-glucan microfibril crystallization, a major mechanism of the cell wall formation (By similarity).	No verified direct reference in this release

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027374 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006970 response to osmotic stress Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009832 plant-type cell wall biogenesis Biological Process

GO:0009833 plant-type primary cell wall biogenesis Biological Process

GO:0009834 plant-type secondary cell wall biogenesis Biological Process

GO:0030244 cellulose biosynthetic process Biological Process

GO:0042742 defense response to bacterium Biological Process

GO:0050832 defense response to fungus Biological Process

GO:0071555 cell wall organization Biological Process

GO:0005886 plasma membrane Cellular Component

GO:0009505 plant-type cell wall Cellular Component

GO:0008270 zinc ion binding Molecular Function

KEGG gene cross-reference

ath:AT4G18780

ath:AT5G44030

dosa:Os01g0750300

dosa:Os07g0208500

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.528

Rank 1 · TkA07G053480 · TK1151

Endoplasmic reticulum0.233

Rank 2 · TkA07G053480 · TK1151

Golgi apparatus0.176

Rank 3 · TkA07G053480 · TK1151

Cytoplasm0.142

Rank 4 · TkA07G053480 · TK1151

Lysosome / Vacuole0.091

Rank 5 · TkA07G053480 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF14569zf-UDP6-60 aa

PF02318FYVE_28-61 aa

PF14570zf-RING_49-60 aa

PF03552Cellulose_synt255-966 aa

PF13632Glyco_trans_2_3457-520 aa

PF13632Glyco_trans_2_3664-769 aa

PF13632Glyco_trans_2_3902-946 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G053480	`PF14569`	zf-UDP	6	60	5.5e-15	55.9
TkA07G053480	`PF02318`	FYVE_2	8	61	0.051	14.5
TkA07G053480	`PF14570`	zf-RING_4	9	60	0.25	11.9
TkA07G053480	`PF03552`	Cellulose_synt	255	966		1342.7
TkA07G053480	`PF13632`	Glyco_trans_2_3	457	520	2.8e-05	24.7
TkA07G053480	`PF13632`	Glyco_trans_2_3	664	769	2.8e-05	24.7
TkA07G053480	`PF13632`	Glyco_trans_2_3	902	946	2.8e-05	24.7

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8LPK5`	Arabidopsis thaliana	sp\|Q8LPK5\|CESA8_ARATH Cellulose synthase A catalytic subunit 8 [UDP-forming]	79.200%	Swiss-Prot	High
`Q84JA6`	Arabidopsis thaliana	sp\|Q84JA6\|CESA4_ARATH Cellulose synthase A catalytic subunit 4 [UDP-forming]	64.400%	Swiss-Prot	High
`A2WV32`	Oryza sativa subsp. indica	sp\|A2WV32\|CESA4_ORYSI Cellulose synthase A catalytic subunit 4 [UDP-forming]	74.500%	Swiss-Prot	High
`Q5JN63`	Oryza sativa subsp. japonica	sp\|Q5JN63\|CESA4_ORYSJ Cellulose synthase A catalytic subunit 4 [UDP-forming]	74.400%	Swiss-Prot	High
`A2Z1C8`	Oryza sativa subsp. indica	sp\|A2Z1C8\|CESA9_ORYSI Cellulose synthase A catalytic subunit 9 [UDP-forming]	62.600%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card