TkA07G050710 | RubberDandelionOmics

Gene overview

TkA07G050710

Reference: TK1151 Chr: Chr07 Coordinates: 13482167-13486935 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2561 bp · TkA07G050710|TK1151|cDNA

AAAACACATTGCTTATGCCTTATAGTATTCCTCAAATCCAAATTGGACTCTAAAAAGGTCAAAACGTAAGAGACTAGTTGAAGTCATCTTTGATTACATTTCTGATAGTTCAATTCTCCTCCAGACTTGCAAGTTTCTGATCGACTATCAAGGTTTCATCGGTAGCAGCTTCTACAGTTCGGCTCCTACCCAGTTCACGGGAATCAGAACTGGCAGCTGGAGTAAAACGTGATAGATCATATCAGTAAGCATGGCGGGAA...

CDS

Download CDS FASTA

1683 bp · TkA07G050710|TK1151|CDS

ATGGCGGGAACTGAGACTGGACCTGTTCTACAATTTGCACCTTTTCAGAGCTCTGTGGATGCTGGTTTTTGGCATGAGTTATCTTCATTGAAGCTCAACAAACTAAAAACTGATGAATCACCAATTTCAATAACTGGTTTTTACACACCTTGCTCCAATTCTCAAGTATCTAGCCATCTAACTCTGCTTACTGAATCCCTGCCAACTGACCCAAGTGATGAACAACAAGCTGCAACAAACCTTGGGAACAGAAACAAATG...

Protein

Download Protein FASTA

560 aa · TkA07G050710|TK1151|PROTEIN

MAGTETGPVLQFAPFQSSVDAGFWHELSSLKLNKLKTDESPISITGFYTPCSNSQVSSHLTLLTESLPTDPSDEQQAATNLGNRNKCSVPGILYNTNTLEGYHALNKQALLKAEAKKIWDDIRSGRAEENSCVLSRFLVISFADLKKFNFYYWFAFPALVLNPPATLLHLKPASKWFTSQEAESVSACCNEWRTSKSTAGVPFFLVSISSNSNATIKPLKDYESCQQKGHKILFGFYDPCHLPNNPGWPLRNLLAFISFK...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G050710`
TK1151 ID	TkA07G050710
OH-1004 ID	LXL04_027333
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	99.200
Protein coverage (%)	TK1151 91.607 / OH-1004 46.516 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G050710

Location Chr07:13482167-13486935 (-)

Description Similar to ATG7: Ubiquitin-like modifier-activating enzyme atg7

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g45900`	E1-like activating enzyme involved in the 2 ubiquitin-like systems required for cytoplasm to vacuole transport (Cvt) and autophagy.	The APG8/12-activating enzyme APG7 is required for proper nutrient recycling and senescence in Arabidopsis thaliana.2002 · DOI: 10.1074/jbc.m204630200 Highly oxidized peroxisomes are selectively degraded via autophagy in Arabidopsis.2013 · DOI: 10.1105/tpc.113.116947 Delayed degradation of chlorophylls and photosynthetic proteins in Arabidopsis autophagy mutants during stress-induced leaf yellowing.2014 · DOI: 10.1093/jxb/eru008

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027333 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000045 autophagosome assembly Biological Process

GO:0000422 autophagy of mitochondrion Biological Process

GO:0000423 mitophagy Biological Process

GO:0006497 protein lipidation Biological Process

GO:0006914 autophagy Biological Process

GO:0006995 cellular response to nitrogen starvation Biological Process

GO:0007005 mitochondrion organization Biological Process

GO:0007623 circadian rhythm Biological Process

GO:0008283 cell population proliferation Biological Process

GO:0009267 cellular response to starvation Biological Process

GO:0009749 response to glucose Biological Process

GO:0009791 post-embryonic development Biological Process

KEGG gene cross-reference

ath:AT5G45900

gga:415961

hsa:10533

mmu:74244

rno:312647

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.606

Rank 1 · TkA07G050710 · TK1151

Nucleus0.329

Rank 2 · TkA07G050710 · TK1151

Mitochondrion0.117

Rank 3 · TkA07G050710 · TK1151

Peroxisome0.101

Rank 4 · TkA07G050710 · TK1151

Cell membrane0.060

Rank 5 · TkA07G050710 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF16420ATG7_N10-325 aa

PF028262-Hacid_dh_C335-413 aa

PF00899ThiF342-515 aa

PF01488Shikimate_DH352-387 aa

PF16420ATG7_N444-491 aa

PF01488Shikimate_DH454-476 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G050710	`PF16420`	ATG7_N	10	325	5.1e-103	345.6
TkA07G050710	`PF02826`	2-Hacid_dh_C	335	413	0.049	13.7
TkA07G050710	`PF00899`	ThiF	342	515	6.2e-28	98.3
TkA07G050710	`PF01488`	Shikimate_DH	352	387	0.0091	16.8
TkA07G050710	`PF16420`	ATG7_N	444	491	5.1e-103	345.6
TkA07G050710	`PF01488`	Shikimate_DH	454	476	0.0091	16.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94CD5`	Arabidopsis thaliana	sp\|Q94CD5\|ATG7_ARATH Ubiquitin-like modifier-activating enzyme atg7	67.500%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card