TkA07G045370 | RubberDandelionOmics

Gene overview

TkA07G045370

Reference: TK1151 Chr: Chr07 Coordinates: 12071210-12077217 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1831 bp · TkA07G045370|TK1151|cDNA

CATCCACAGCCGGTTTTCGAAAGTTACCTTCAGATTAAGCAGTAGTTGAGGGACATTTTGGTAATTGTAAGTTTATAGATAGTTCCAAAGACTCATTCTAAGACATCAAGATTGGTACGTGTGTGCGTATCCACCTAAACATAAACTCAACTTGGCGTCCAAGCAACCCTAATTCTTTATGTCTACAAAATACCATTTCATGCCTCCTCTTTTCACCAAATAAATAAATCAACAAAAAAGATACATAAAGTCTCCATTTT...

CDS

Download CDS FASTA

882 bp · TkA07G045370|TK1151|CDS

ATGACATGGTGTAATGATGAAAGTAGTACCCTCCAAAATCTCTCAACTTCTTCAACAGAAAGAAGCATCATTCAATCAAGAAATCCCAAGAATATTATCACAAGTTCTTGTCCTTCTTGTGGACATACCATCCAACTTCAAGCTAAGGGGTTGATTCCTGATTTGCCGGGATTACCTGCTGGAGTGAAGTTTGACCCCACCGATCAAGAAATTATTGAGCATTTGAAAGCTAAGGTTGGATGTGATACAAATGAGCTTCA...

Protein

Download Protein FASTA

293 aa · TkA07G045370|TK1151|PROTEIN

MTWCNDESSTLQNLSTSSTERSIIQSRNPKNIITSSCPSCGHTIQLQAKGLIPDLPGLPAGVKFDPTDQEIIEHLKAKVGCDTNELHPLIDEFIPTIEGETGICYTHPEKLPGVSNDGQIRHFFHRPSKAYTTGTRKRRKVHMDAERGETRWHKTGKTRPVLLSGLVEGYKKILVLYTNYGRQKKPEKTNWVMHQYHLGNSEEEKDGEIVLSKVFFQTQPRNCASSLKELSSVDEKTQKNPKGRNMSFMENYGVSPFIPY...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G045370`
TK1151 ID	TkA07G045370
OH-1004 ID	LXL04_027293
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	99.700
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G045370

Location Chr07:12071210-12077217 (-)

Description Similar to NAC073: NAC domain-containing protein 73

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g28500`	Transcriptional activator that plays a regulatory role in the development of secondary cell wall fibers.	A battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis.2008 · DOI: 10.1105/tpc.108.061325 SND2, a NAC transcription factor gene, regulates genes involved in secondary cell wall development in Arabidopsis fibres and increases fibre cell area in Eucalyptus.2011 · DOI: 10.1186/1471-2229-11-173
`At1g28470`	Transcriptional activator that plays a regulatory role in the development of secondary cell wall fibers.	A battery of transcription factors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis.2008 · DOI: 10.1105/tpc.108.061325
`At4g29230`	Transcription activator involved in xylem formation.	No verified direct reference in this release
`At1g25580`	Transcription factor regulating the transcriptional activation response to gamma irradiation.	Suppressor of gamma response 1 (SOG1) encodes a putative transcription factor governing multiple responses to DNA damage.2009 · DOI: 10.1073/pnas.0810304106 A shared DNA-damage-response pathway for induction of stem-cell death by UVB and by gamma irradiation.2010 · DOI: 10.1016/j.dnarep.2010.06.006 Arabidopsis casein kinase 2 triggers stem cell exhaustion under Al toxicity and phosphate deficiency through activating the DNA damage response pathway.2021 · DOI: 10.1093/plcell/koab005
`At2g33480`	Transcription activator of the mannan synthase CSLA9.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027293 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000077 DNA damage checkpoint signaling Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0010321 regulation of vegetative phase change Biological Process

GO:0010332 response to gamma radiation Biological Process

GO:0040020 regulation of meiotic nuclear division Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

GO:0071555 cell wall organization Biological Process

GO:1900057 positive regulation of leaf senescence Biological Process

GO:1903648 positive regulation of chlorophyll catabolic process Biological Process

GO:1905177 tracheary element differentiation Biological Process

GO:2000652 regulation of secondary cell wall biogenesis Biological Process

KEGG gene cross-reference

ath:AT1G25580

ath:AT1G28470

ath:AT3G04060

ath:AT4G28500

ath:AT4G29230

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.943

Rank 1 · TkA07G045370 · TK1151

Cytoplasm0.118

Rank 2 · TkA07G045370 · TK1151

Cell membrane0.039

Rank 3 · TkA07G045370 · TK1151

Endoplasmic reticulum0.028

Rank 4 · TkA07G045370 · TK1151

Plastid0.018

Rank 5 · TkA07G045370 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF02365NAM59-198 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G045370	`PF02365`	NAM	59	198	5.6e-26	92.1

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O49459`	Arabidopsis thaliana	sp\|O49459\|NAC73_ARATH NAC domain-containing protein 73	67.200%	Swiss-Prot	High
`F4HY61`	Arabidopsis thaliana	sp\|F4HY61\|NAC10_ARATH NAC domain-containing protein 10	77.100%	Swiss-Prot	Medium
`Q9M0F8`	Arabidopsis thaliana	sp\|Q9M0F8\|NAC75_ARATH NAC domain-containing protein 75	66.700%	Swiss-Prot	Medium
`Q6NQK2`	Arabidopsis thaliana	sp\|Q6NQK2\|NAC8_ARATH SUPPRESSOR OF GAMMA RESPONSE 1	53.600%	Swiss-Prot	High
`O22798`	Arabidopsis thaliana	sp\|O22798\|NAC41_ARATH NAC domain-containing protein 41	32.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card