TkA07G039900 | RubberDandelionOmics

Gene overview

TkA07G039900

Reference: TK1151 Chr: Chr07 Coordinates: 10606677-10611222 Strand: + Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

3505 bp · TkA07G039900|TK1151|cDNA

AAAAAATACTTAATATTGATTTTTACCAAATAACACGATTGCCATCTAACAGTACTACGATGTGTTCGTCCCCATCCATTCGAGTCCCGCCGCATTGCGCGGGCAAACAACTTTTTTGTTTAAACAAACAATAAACTAGAAAATATAGCCACGAAAGGTCGAAAGCCATTCGCATTGACGCAAACGTCAGTCTCCCAGTGGATTCTTCATTCATCACTGGATTTACGGCTATGATCTTTGGCTTATTCACAGAAATTAGG...

CDS

Download CDS FASTA

2457 bp · TkA07G039900|TK1151|CDS

ATGAAAGAAACTTATATGGAGAGATTGAATATTAGTAATGATACTTTGAAGATGGATAGTTATGGGTTAACTGATGGAATCTTTGACAAATCAGTTGGAAACAGTTATCAAATATCAGAACCTTATGACAACATGGAAGCCCAATTCATGGATCTTAGCATGTATTCTGAGATTCTTTGTAGTCCCAGTGAGAAACTTTATGCACCATTTATCACAAGCTTAAATAAACCAATTTATTTTGGTTTAAATGATATTGATGA...

Protein

Download Protein FASTA

818 aa · TkA07G039900|TK1151|PROTEIN

MKETYMERLNISNDTLKMDSYGLTDGIFDKSVGNSYQISEPYDNMEAQFMDLSMYSEILCSPSEKLYAPFITSLNKPIYFGLNDIDDTFFDNKTESESTSGFHGVHMANKTQVDCVKNEKHDGKSLVPKKKSSLVNIRKNGKLKNNDEKSAHQAPLQMIPHEKSDISVQDGGLTVPLLKHQRIALSWMTRKETRCTRCCGGILADDQGLGKTISAIALILKERSPASSTENCTKTNQKQTETLNLDEEEDVTSDTKDRKS...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G039900`
TK1151 ID	TkA07G039900
OH-1004 ID	LXL04_027212
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 100.000 / OH-1004 82.543 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G039900

Location Chr07:10606677-10611222 (+)

Description Similar to CHR28: Helicase-like transcription factor CHR28

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At1g50410`	Probable helicase-like transcription factor involved in transcriptional gene silencing.	SUVR2 is involved in transcriptional gene silencing by associating with SNF2-related chromatin-remodeling proteins in Arabidopsis.2014 · DOI: 10.1038/cr.2014.156 SNF2 chromatin remodeler-family proteins FRG1 and -2 are required for RNA-directed DNA methylation.2014 · DOI: 10.1073/pnas.1420515111
`At3g20010`	Probable helicase-like transcription factor involved in transcriptional gene silencing.	SUVR2 is involved in transcriptional gene silencing by associating with SNF2-related chromatin-remodeling proteins in Arabidopsis.2014 · DOI: 10.1038/cr.2014.156 SNF2 chromatin remodeler-family proteins FRG1 and -2 are required for RNA-directed DNA methylation.2014 · DOI: 10.1073/pnas.1420515111
`At5g22750`	Functions in error-free postreplication DNA repair or DNA- damage tolerance (DTT) pathway.	A homolog of ScRAD5 is involved in DNA repair and homologous recombination in Arabidopsis.2008 · DOI: 10.1104/pp.108.116806 RAD5A, RECQ4A, and MUS81 have specific functions in homologous recombination and define different pathways of DNA repair in Arabidopsis thaliana.2010 · DOI: 10.1105/tpc.110.078568 RAD5a and REV3 function in two alternative pathways of DNA-damage tolerance in Arabidopsis.2011 · DOI: 10.1016/j.dnarep.2011.04.009 AtRAD5A is a DNA translocase harboring a HIRAN domain which confers binding to branched DNA structures and is required for DNA repair in vivo.2016 · DOI: 10.1111/tpj.13283
`At5g43530`	Possesses intrinsic ATP-dependent nucleosome-remodeling activity.	A homolog of ScRAD5 is involved in DNA repair and homologous recombination in Arabidopsis.2008 · DOI: 10.1104/pp.108.116806
`At5g05130`	Possesses intrinsic ATP-dependent nucleosome-remodeling activity.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027212 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0000724 double-strand break repair via homologous recombination Biological Process

GO:0006281 DNA repair Biological Process

GO:0006325 chromatin organization Biological Process

GO:0006351 DNA-templated transcription Biological Process

GO:0009294 DNA-mediated transformation Biological Process

GO:0036297 interstrand cross-link repair Biological Process

GO:0045003 double-strand break repair via synthesis-dependent strand annealing Biological Process

GO:0080188 gene silencing by siRNA-directed DNA methylation Biological Process

GO:0000785 chromatin Cellular Component

GO:0005634 nucleus Cellular Component

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

KEGG gene cross-reference

ath:AT1G50410

ath:AT3G20010

ath:AT5G22750

ath:AT5G43530

spo:2542440

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.803

Rank 1 · TkA07G039900 · TK1151

Cytoplasm0.202

Rank 2 · TkA07G039900 · TK1151

Mitochondrion0.054

Rank 3 · TkA07G039900 · TK1151

Cell membrane0.028

Rank 4 · TkA07G039900 · TK1151

Plastid0.019

Rank 5 · TkA07G039900 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF00176SNF2-rel_dom180-539 aa

PF17120zf-RING_16180-200 aa

PF00097zf-C3HC4186-198 aa

PF13639zf-RING_2187-198 aa

PF23555zf-RING_Vps41193-210 aa

PF12678zf-rbx1568-613 aa

PF13920zf-C3HC4_3575-621 aa

PF24921RING_XB3-XBAT31575-610 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G039900	`PF00176`	SNF2-rel_dom	180	539	2.4e-65	221.2
TkA07G039900	`PF17120`	zf-RING_16	180	200	6.8	7.1
TkA07G039900	`PF00097`	zf-C3HC4	186	198	7.6e-08	32.8
TkA07G039900	`PF13639`	zf-RING_2	187	198	0.0003	21.7
TkA07G039900	`PF23555`	zf-RING_Vps41	193	210	8.3	6.8
TkA07G039900	`PF12678`	zf-rbx1	568	613	0.0017	19.3
TkA07G039900	`PF13920`	zf-C3HC4_3	575	621	3.5e-06	27.4
TkA07G039900	`PF24921`	RING_XB3-XBAT31	575	610	0.00071	20.3
TkA07G039900	`PF12861`	zf-ANAPC11	575	618	0.14	12.9
TkA07G039900	`PF13923`	zf-C3HC4_2	576	612	2.2e-08	34.5
TkA07G039900	`PF00097`	zf-C3HC4	576	612	7.6e-08	32.8
TkA07G039900	`PF14634`	zf-RING_5	576	618	2.6e-05	24.8
TkA07G039900	`PF13445`	zf-RING_UBOX	576	612	4.9e-05	24.0
TkA07G039900	`PF13639`	zf-RING_2	576	613	0.0003	21.7
TkA07G039900	`PF14447`	Prok-RING_4	576	626	0.00055	20.5
TkA07G039900	`PF15227`	zf-C3HC4_4	576	612	0.2	12.5

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q94BR5`	Arabidopsis thaliana	sp\|Q94BR5\|CHR28_ARATH Helicase-like transcription factor CHR28	52.400%	Swiss-Prot	High
`Q9LHE4`	Arabidopsis thaliana	sp\|Q9LHE4\|CHR27_ARATH Helicase-like transcription factor CHR27	49.600%	Swiss-Prot	Medium
`Q9FNI6`	Arabidopsis thaliana	sp\|Q9FNI6\|SM3L2_ARATH DNA repair protein RAD5A	35.700%	Swiss-Prot	Medium
`Q9FIY7`	Arabidopsis thaliana	sp\|Q9FIY7\|SM3L3_ARATH DNA repair protein RAD5B	35.600%	Swiss-Prot	Medium
`Q9FF61`	Arabidopsis thaliana	sp\|Q9FF61\|SM3L1_ARATH Putative SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 3-like 1	33.500%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card