TkA07G035730 | RubberDandelionOmics

Gene overview

TkA07G035730

Reference: TK1151 Chr: Chr07 Coordinates: 9517147-9520279 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

2588 bp · TkA07G035730|TK1151|cDNA

TAAAACCCCACAATGTGTTTGTCCATCTTTCATATTTCATATTTGTAAACAAAAAACAACAAAAAAAATGGTGATAAATAGTCCAAATGTGGGTCAATACAGGGTACCACTTGTATGTCTGTTGATCATAGCCATGGATCTCACTGCAGGGATTCTTGGTATCCAAGCCGAGGTAGCTCAAAACAAGGTGCAAAATCTAAGATTATGGGTCTTGGAATGTAGAGATCCAAGTTATCAAGCATTCAAACTAGGGTTTGCAG...

CDS

Download CDS FASTA

630 bp · TkA07G035730|TK1151|CDS

ATGGTGATAAATAGTCCAAATGTGGGTCAATACAGGGTACCACTTGTATGTCTGTTGATCATAGCCATGGATCTCACTGCAGGGATTCTTGGTATCCAAGCCGAGGTAGCTCAAAACAAGGTGCAAAATCTAAGATTATGGGTCTTGGAATGTAGAGATCCAAGTTATCAAGCATTCAAACTAGGGTTTGCAGCCGCAGTGCTTTTAGCATTTGCTCACGCCATAGCAAATTTACTTGGTGGGTGCCACGTTGTATGGTC...

Protein

Download Protein FASTA

209 aa · TkA07G035730|TK1151|PROTEIN

MVINSPNVGQYRVPLVCLLIIAMDLTAGILGIQAEVAQNKVQNLRLWVLECRDPSYQAFKLGFAAAVLLAFAHAIANLLGGCHVVWSKPELDRATSNKQFAMASLILSWITLVIGFGLLIAGVMANSGPRKSCGVSNHRYLSIGGIACIVHGMFAVSYYISATTVEKEENKLNPHGPMMNHPPGPMMDPSGPMMIPRGPLHLPTASAPV

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G035730`
TK1151 ID	TkA07G035730
OH-1004 ID	LXL04_027153
Relationship / confidence	Sequence Supported Annotation Or Model Conflict / Review
Protein identity (%)	100.000
Protein coverage (%)	TK1151 99.522 / OH-1004 96.744 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G035730

Location Chr07:9517147-9520279 (-)

Description Protein of unknown function

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g21310`	Involved, partially redundantly with VCC/DEAL1 and DEAL3, to ensure bilateral symmetry development and early leaf margin patterning, probably via the regulation of auxin and CUC2 distribution.	Members of the DEAL subfamily of the DUF1218 gene family are required for bilateral symmetry but not for dorsoventrality in Arabidopsis leaves.2018 · DOI: 10.1111/nph.14898
`At2g32280`	Required, together with OPS, for embryo provasculature development and cotyledon vascular complexity and connectivity.	Members of the DEAL subfamily of the DUF1218 gene family are required for bilateral symmetry but not for dorsoventrality in Arabidopsis leaves.2018 · DOI: 10.1111/nph.14898
`At1g11500`	Involved, partially redundantly with VCC/DEAL1 and DEAL2, to ensure bilateral symmetry development and early leaf margin patterning, probably via the regulation of auxin and CUC2 distribution.	Members of the DEAL subfamily of the DUF1218 gene family are required for bilateral symmetry but not for dorsoventrality in Arabidopsis leaves.2018 · DOI: 10.1111/nph.14898

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027153 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0009855 determination of bilateral symmetry Biological Process

GO:0010087 phloem or xylem histogenesis Biological Process

GO:0010305 leaf vascular tissue pattern formation Biological Process

GO:0010588 cotyledon vascular tissue pattern formation Biological Process

GO:0048366 leaf development Biological Process

GO:0048825 cotyledon development Biological Process

GO:0140964 intracellular auxin homeostasis Biological Process

GO:0005789 endoplasmic reticulum membrane Cellular Component

GO:0009507 chloroplast Cellular Component

KEGG gene cross-reference

ath:AT1G05291

ath:AT1G11500

ath:AT2G32280

ath:AT4G21310

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cell membrane0.708

Rank 1 · TkA07G035730 · TK1151

Cytoplasm0.122

Rank 2 · TkA07G035730 · TK1151

Endoplasmic reticulum0.113

Rank 3 · TkA07G035730 · TK1151

Lysosome / Vacuole0.092

Rank 4 · TkA07G035730 · TK1151

Nucleus0.057

Rank 5 · TkA07G035730 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF11239DUF304016-34 aa

PF06749DUF121865-152 aa

PF11239DUF304065-80 aa

PF11239DUF304090-152 aa

PF05915TMEM_230_134103-162 aa

PF06749DUF1218154-173 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G035730	`PF11239`	DUF3040	16	34	0.16	12.9
TkA07G035730	`PF06749`	DUF1218	65	152	1.6e-18	67.6
TkA07G035730	`PF11239`	DUF3040	65	80	0.16	12.9
TkA07G035730	`PF11239`	DUF3040	90	152	0.16	12.9
TkA07G035730	`PF05915`	TMEM_230_134	103	162	0.00022	22.0
TkA07G035730	`PF06749`	DUF1218	154	173	1.6e-18	67.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`O81898`	Arabidopsis thaliana	sp\|O81898\|DEAL2_ARATH Protein DESIGUAL 2	59.500%	Swiss-Prot	High
`Q9ZV57`	Arabidopsis thaliana	sp\|Q9ZV57\|DEAL1_ARATH Protein VASCULATURE COMPLEXITY AND CONNECTIVITY	51.900%	Swiss-Prot	High
`A2RVQ4`	Arabidopsis thaliana	sp\|A2RVQ4\|DEAL3_ARATH Protein DESIGUAL 3	42.700%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card