Gene Card
Gene overview
cDNA / CDS / Protein Sequences
1084 bp · TkA07G035300|TK1151|cDNA
TCAACAAATAAAAATGAAACCCACAATTTCATTTGTCTTTCTTCTTTTACCAATCATCAATGTTGTCGATCTCGTCATATCTCAATTTCCATCAGATATTATCTACAAATGTAGAAACACCGGCAACTACACAACAAGGACCGATTACGCCAGAAACCTCAACGTCGCAATAAATAAAGTCGGCATGGAAAACAAAATTAACGGAAATTTCTACAGTTCGTCATGGGGCGGTAACGAAGCGGCACATGCCCTCGCACTTT...
807 bp · TkA07G035300|TK1151|CDS
ATGAAACCCACAATTTCATTTGTCTTTCTTCTTTTACCAATCATCAATGTTGTCGATCTCGTCATATCTCAATTTCCATCAGATATTATCTACAAATGTAGAAACACCGGCAACTACACAACAAGGACCGATTACGCCAGAAACCTCAACGTCGCAATAAATAAAGTCGGCATGGAAAACAAAATTAACGGAAATTTCTACAGTTCGTCATGGGGCGGTAACGAAGCGGCACATGCCCTCGCACTTTGTTCCAATGTTGG...
Protein
Download Protein FASTA268 aa · TkA07G035300|TK1151|PROTEIN
MKPTISFVFLLLPIINVVDLVISQFPSDIIYKCRNTGNYTTRTDYARNLNVAINKVGMENKINGNFYSSSWGGNEAAHALALCSNVGTKWGANCSQCVTRLINTQIKYCPDQKEGVMWTSNCMFRYSDRKIVGVLDDWVWILKPERGSYFVSDQSIHDLATRLQREASGGTNARKAALGIIASPRKTYGAMQCTPDLSKELCRKCLQHIITSHVNCCSRRPAARMYSPNCYFVYSLQEFSKWKDGLSTDLGFALQSIHNA...
Flanking Sequence Download
Sequence orientation and download details
Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.
ID Mapping
| Input ID | TkA07G035300 |
|---|---|
| TK1151 ID | TkA07G035300 |
| OH-1004 ID | LXL04_027144 |
| Relationship / confidence | Rbh High Identity Coverage Synteny / Strict |
| Protein identity (%) | 99.300 |
| Protein coverage (%) | TK1151 100.000 / OH-1004 93.706Coverage and evidenceCoverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation. |
| Source version | TK1151 / GWHBCHF00000000 |
SNP / Indel variants and carrier samplesCRA009020 · TK1151
Expand to load variant records for this gene.
Basic Information and Functional Annotation
| Gene ID | TkA07G035300 | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Location | Chr07:9395567-9397132 (-) | |||||||||
| Description | Similar to CRK29: Cysteine-rich receptor-like protein kinase 29 | |||||||||
| Arabidopsis / Rice Reference Genes and Papers |
Download references for this gene Arabidopsis
RiceNo hit for this species in the current source table. | |||||||||
| Functional annotation source | View annotation sourcesFunctional annotation source: OH1004 · | |||||||||
| GO annotations (OH1004 source) | GO:0006955 immune response Biological Process GO:0006979 response to oxidative stress Biological Process GO:0007165 signal transduction Biological Process GO:0009626 plant-type hypersensitive response Biological Process GO:0009737 response to abscisic acid Biological Process GO:0042742 defense response to bacterium Biological Process GO:0000325 plant-type vacuole Cellular Component GO:0005576 extracellular region Cellular Component GO:0005773 vacuole Cellular Component GO:0005829 cytosol Cellular Component GO:0005886 plasma membrane Cellular Component GO:0009505 plant-type cell wall Cellular Component | |||||||||
| KEGG gene cross-reference | ath:AT1G61750 ath:AT3G22060 ath:AT4G05200 ath:AT4G21230 ath:AT4G21410 These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene. |
Gene expression
View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.
Data sources and gene correspondence
Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.
Subcellular Localization Top 5
Computational predictions or homology annotations below do not replace localization experiments.
LocPro · Direct prediction · Computational prediction, not experimental localization
Predicted Functional Domains
Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.
PF28686HUA1_small31-37 aaPF01657Stress-antifung32-128 aaPF28686HUA1_small83-100 aaPF26780DUF825285-123 aaPF00097zf-C3HC494-110 aaPF01657Stress-antifung155-236 aaPF26780DUF8252200-219 aaPF00097zf-C3HC4201-216 aa| Gene ID | Domain ID | Domain Name | Start aa | End aa | E-value | Score |
|---|---|---|---|---|---|---|
| TkA07G035300 | PF28686 | HUA1_small | 31 | 37 | 6.4 | 7.4 |
| TkA07G035300 | PF01657 | Stress-antifung | 32 | 128 | 1.7e-25 | 90.2 |
| TkA07G035300 | PF28686 | HUA1_small | 83 | 100 | 6.4 | 7.4 |
| TkA07G035300 | PF26780 | DUF8252 | 85 | 123 | 0.066 | 14.4 |
| TkA07G035300 | PF00097 | zf-C3HC4 | 94 | 110 | 1.8 | 9.2 |
| TkA07G035300 | PF01657 | Stress-antifung | 155 | 236 | 1.7e-25 | 90.2 |
| TkA07G035300 | PF26780 | DUF8252 | 200 | 219 | 0.066 | 14.4 |
| TkA07G035300 | PF00097 | zf-C3HC4 | 201 | 216 | 1.8 | 9.2 |
| TkA07G035300 | PF28686 | HUA1_small | 202 | 205 | 6.4 | 7.4 |
Arabidopsis / Rice Protein Homology
Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.