TkA07G026720 | RubberDandelionOmics

Gene overview

TkA07G026720

Reference: TK1151 Chr: Chr07 Coordinates: 7201571-7206111 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

794 bp · TkA07G026720|TK1151|cDNA

CTAAGTCACACACTCACTAATTATGTAAACATTGTTCAAGAAATTATTCCTTTTTGTTATGGAATTATGAAAGTGAAAAAAAGTAAATTATGTAATCGAATTTTGGAGCTAGTGGATCCTCGTCAATCATTCCACTTTTTCCATCATTTTTAGCCCAAATTAATCAATCATTCCCAATTTTGAATTCACGATGATGGGAGGAAATAAATCAAATTCGAACCAGAGCTCCAATAACGACGACGTTCATCGCCACCGTCAGG...

CDS

Download CDS FASTA

489 bp · TkA07G026720|TK1151|CDS

ATGATGGGAGGAAATAAATCAAATTCGAACCAGAGCTCCAATAACGACGACGTTCATCGCCACCGTCAGGTAAACAACGCAGTCGAGGTTGAATTCACCTCCGACGATGAAGGATGGAGTTCCGACAGTTCAGGGTCGTCGGGGGGGAGCCTGGCGGCGAGTTTACGCCATTTTGCGGAGGGTATGATGAGGCGGGAAGCGGCGGAGCTGGAGATGATGAAGGCAAGGGAGGCGGCGAGGATTGCGGCGGAGAACCGGAG...

Protein

Download Protein FASTA

163 aa · TkA07G026720|TK1151|PROTEIN

MMGGNKSNSNQSSNNDDVHRHRQVNNAVEVEFTSDDEGWSSDSSGSSGGSLAASLRHFAEGMMRREAAELEMMKAREAARIAAENRRLERETELTEMLLKTQLQITSFLCSGTSDRKRKRSGEDDGDSPGSVQSLQRQTLPSKCHVGGFHFLGSLPLANFLWW

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G026720`
TK1151 ID	TkA07G026720
OH-1004 ID	LXL04_027032
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	100.000
Protein coverage (%)	TK1151 81.595 / OH-1004 99.254 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G026720

Location Chr07:7201571-7206111 (-)

Description Similar to At4g22160: Uncharacterized protein At4g22160

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At4g22160`	Uncharacterized protein At4g22160.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_027032 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0005634 nucleus Cellular Component

KEGG gene cross-reference

ath:AT4G22160

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.946

Rank 1 · TkA07G026720 · TK1151

Cytoplasm0.108

Rank 2 · TkA07G026720 · TK1151

Cell membrane0.040

Rank 3 · TkA07G026720 · TK1151

Endoplasmic reticulum0.025

Rank 4 · TkA07G026720 · TK1151

Plastid0.013

Rank 5 · TkA07G026720 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF15811SVIP8-16 aa

PF30936SOFL9-119 aa

PF04538BEX19-92 aa

PF22119GST_C_845-114 aa

PF06621SIM_C59-119 aa

PF15811SVIP70-104 aa

PF06621SIM_C140-163 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G026720	`PF15811`	SVIP	8	16	0.46	11.4
TkA07G026720	`PF30936`	SOFL	9	119	0.052	14.7
TkA07G026720	`PF04538`	BEX	19	92	0.005	18.2
TkA07G026720	`PF22119`	GST_C_8	45	114	0.12	13.4
TkA07G026720	`PF06621`	SIM_C	59	119	0.54	10.8
TkA07G026720	`PF15811`	SVIP	70	104	0.46	11.4
TkA07G026720	`PF06621`	SIM_C	140	163	0.54	10.8

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q8L8L9`	Arabidopsis thaliana	sp\|Q8L8L9\|Y4216_ARATH Uncharacterized protein At4g22160	47.600%	Swiss-Prot	Medium

JBrowse

View in Genome Browser

Gene Card