TkA07G023760 | RubberDandelionOmics

Gene overview

TkA07G023760

Reference: TK1151 Chr: Chr07 Coordinates: 6440118-6444344 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1646 bp · TkA07G023760|TK1151|cDNA

CTTTCCATGACACTTTACTTGATATATAAAGTCCATCAATTTTATAATATGGAAACTTTGATTTCATATTACTATCATCTTATCAAAAGTATTTTTTGCCAGGTAACATCACTACAATCTACCCAATTTTATAAAAAAGAATTTTTTTTGAGTTTATATAAATCAATTACATTTAAGAAAGTAGGTTTGGTCTTAAATTTATACAGATGAGAATCGGTTATAGTTAAATTAGGTTTCAGGAAGCCAATAAGGGGCCCAGA...

CDS

Download CDS FASTA

1020 bp · TkA07G023760|TK1151|CDS

ATGAAAGGTCTCTTCAAGTCAAAACCTAAGACACCGGTTGACCTCGTTCGTCAAACTCGGGATCTCCTCATATACGTCGACACCAATCCCGATAGTCGAGAAAGCAAGCGCGAAGAAAAGTTTGCAACCCTGAGTAAGCTTCTTCGTGAGCTTAAACAAATTCTGTATGGGAACAGTGAAGCTGAACCGGTTTCTGAAGCTTGTGCTCAATTGACTCAAGAGTTCTTCAAAGAAAACACACTTCGTTTAGTGATAGTTTG...

Protein

Download Protein FASTA

339 aa · TkA07G023760|TK1151|PROTEIN

MKGLFKSKPKTPVDLVRQTRDLLIYVDTNPDSRESKREEKFATLSKLLRELKQILYGNSEAEPVSEACAQLTQEFFKENTLRLVIVCLPKLNLEARKDATQIVANLQRQQVHSRLIACDYLEANIDLMDILALGYENPDMALHYGAMLRECIRHQSVARYVLESAHMKKFFDFIQLPNFDIAADAAATFKELLTRHKSTVAEFLTKNYDWFFAEYNSKLLESPNYITRRQAIKLLGDMLLDRSNSAVMTRYACSRDNLRI...

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G023760`
TK1151 ID	TkA07G023760
OH-1004 ID	LXL04_017621
Relationship / confidence	Non Reciprocal Best Hit / Complex relationship
Protein identity (%)	61.300
Protein coverage (%)	TK1151 99.115 / OH-1004 95.442 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G023760

Location Chr07:6440118-6444344 (-)

Description Similar to At5g47540: Putative MO25-like protein At5g47540

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g47540`	Putative MO25-like protein At5g47540.	No verified direct reference in this release
`At4g17270`	Putative MO25-like protein At4g17270.	No verified direct reference in this release
`At2g03410`	MO25-like protein At2g03410.	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_017621 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0035556 intracellular signal transduction Biological Process

GO:0005737 cytoplasm Cellular Component

GO:0005829 cytosol Cellular Component

GO:0009536 plastid Cellular Component

GO:0010494 cytoplasmic stress granule Cellular Component

GO:0043539 protein serine/threonine kinase activator activity Molecular Function

KEGG gene cross-reference

ath:AT2G03410

ath:AT4G17270

ath:AT5G47540

hsa:81617

mmu:69008

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Cytoplasm0.617

Rank 1 · TkA07G023760 · TK1151

Golgi apparatus0.226

Rank 2 · TkA07G023760 · TK1151

Nucleus0.206

Rank 3 · TkA07G023760 · TK1151

Cell membrane0.195

Rank 4 · TkA07G023760 · TK1151

Lysosome / Vacuole0.131

Rank 5 · TkA07G023760 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF08569Mo254-334 aa

PF23179bHLH_INO217-62 aa

PF13646HEAT_2219-273 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G023760	`PF08569`	Mo25	4	334	6.1e-133	443.9
TkA07G023760	`PF23179`	bHLH_INO2	17	62	0.19	12.6
TkA07G023760	`PF13646`	HEAT_2	219	273	0.14	13.2

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q9FGK3`	Arabidopsis thaliana	sp\|Q9FGK3\|MO25N_ARATH Putative MO25-like protein At5g47540	83.600%	Swiss-Prot	High
`Q9M0M4`	Arabidopsis thaliana	sp\|Q9M0M4\|MO25M_ARATH Putative MO25-like protein At4g17270	79.500%	Swiss-Prot	High
`Q9ZQ77`	Arabidopsis thaliana	sp\|Q9ZQ77\|MO25L_ARATH MO25-like protein At2g03410	63.300%	Swiss-Prot	High

JBrowse

View in Genome Browser

Gene Card