TkA07G022320 | RubberDandelionOmics

Gene overview

TkA07G022320

Reference: TK1151 Chr: Chr07 Coordinates: 6087114-6090396 Strand: - Type: protein_coding

cDNA / CDS / Protein Sequences

Available sequence downloads CDS FASTA Protein FASTA cDNA FASTA

cDNA

1004 bp · TkA07G022320|TK1151|cDNA

CGTGTCCTCTCTACCACGTGTCATCGTTATAATTGTCCACATTTTCCCAAATCAGCACACTCCTCATCTTTATATGTCACTATCCTTCATTAAATTCCAACTTGTACTAAATTTAAAGTGGTAGAGAGTGGGAGAGAAAAAATGGAGCATAACGGAGTTGTCCATGGCTATCAGAGACTCCATCCACATCCAACAACTGGACCACGGATGCAAATGCACCCACCGGAATATTCCACTACCACCACCGAATGCCTCGTCCG...

CDS

Download CDS FASTA

657 bp · TkA07G022320|TK1151|CDS

ATGGAGCATAACGGAGTTGTCCATGGCTATCAGAGACTCCATCCACATCCAACAACTGGACCACGGATGCAAATGCACCCACCGGAATATTCCACTACCACCACCGAATGCCTCGTCCGAGAACAAGACCGTTTCATGCCAATCGCAAACGTCATCCGCATCATGCGAAAAACCCTCCCCACTCACGCCAAAATCTCCGACGACGCTAAAGAAACAATCCAAGAATGCGTTTCCGAGTTCATCAGCTTCGTCACCGGCGA...

Protein

Download Protein FASTA

218 aa · TkA07G022320|TK1151|PROTEIN

MEHNGVVHGYQRLHPHPTTGPRMQMHPPEYSTTTTECLVREQDRFMPIANVIRIMRKTLPTHAKISDDAKETIQECVSEFISFVTGEANDRCQREQRKTITAEDILWAMSKLGFDDYIEPLTIYLHRYRELDGGERGSMRGGDPSLMKRSGVGNIDDFAPVFRMGSQLVGPPPPPVPPAATVAGFFNDAAIAGGGGGVGTSRRATGVAGFQPYVQFKE

Flanking Sequence Download

Sequence orientation and download details

Upstream/downstream are capped at 10000 bp per side. Negative-strand genes are reverse-complemented so the final FASTA follows transcriptional 5′→3′ orientation.

ID Mapping

Input ID	`TkA07G022320`
TK1151 ID	TkA07G022320
OH-1004 ID	LXL04_026979
Relationship / confidence	Rbh High Identity Coverage Synteny / Strict
Protein identity (%)	98.600
Protein coverage (%)	TK1151 100.000 / OH-1004 100.000 Coverage and evidence Coverage is the aligned span of the best-scoring HSP divided by representative protein length. A homolog match does not establish functional validation.
Source version	TK1151 / GWHBCHF00000000

Open Full ID Mapping

SNP / Indel variants and carrier samplesCRA009020 · TK1151

Expand to load variant records for this gene.

Basic Information and Functional Annotation

Gene ID TkA07G022320

Location Chr07:6087114-6090396 (-)

Description Similar to NFYB6: Nuclear transcription factor Y subunit B-6

Arabidopsis / Rice Reference Genes and Papers

Download references for this gene

Arabidopsis

Reference gene ID	Possible function	Papers / DOI
`At5g47670`	Component of the NF-Y/HAP transcription factor complex.	No verified direct reference in this release
`At1g21970`	Component of the NF-Y/HAP transcription factor complex.	Arabidopsis LEAFY COTYLEDON1 represents a functionally specialized subunit of the CCAAT binding transcription factor.2003 · DOI: 10.1073/pnas.0437909100 LEAFY COTYLEDON1 controls seed storage protein genes through its regulation of FUSCA3 and ABSCISIC ACID INSENSITIVE3.2005 · DOI: 10.1093/pcp/pci048 Arabidopsis LEAFY COTYLEDON1 is sufficient to induce embryo development in vegetative cells.1998 · DOI: 10.1016/s0092-8674(00)81463-4
`At3g53340`	Component of the NF-Y/HAP transcription factor complex.	No verified direct reference in this release
`At2g37060`	Component of the NF-Y/HAP transcription factor complex.	No verified direct reference in this release
`At2g38880`	Component of the NF-Y/HAP transcription factor complex (By similarity).	No verified direct reference in this release

Rice

No hit for this species in the current source table.

Functional annotation source

View annotation sources

Functional annotation source: OH1004 · LXL04_026979 · GCA_047496595.1_OSU_TarKok_2.0. These OH1004 annotations are retrieved through ID mapping; the Arabidopsis/rice table below uses protein alignments from the query reference.

GO annotations (OH1004 source)

GO:0006351 DNA-templated transcription Biological Process

GO:0006355 regulation of DNA-templated transcription Biological Process

GO:0006357 regulation of transcription by RNA polymerase II Biological Process

GO:0009414 response to water deprivation Biological Process

GO:0009738 abscisic acid-activated signaling pathway Biological Process

GO:0009785 blue light signaling pathway Biological Process

GO:0009793 embryo development ending in seed dormancy Biological Process

GO:0010262 somatic embryogenesis Biological Process

GO:0019760 glucosinolate metabolic process Biological Process

GO:0040029 epigenetic regulation of gene expression Biological Process

GO:0045723 positive regulation of fatty acid biosynthetic process Biological Process

GO:0045893 positive regulation of DNA-templated transcription Biological Process

KEGG gene cross-reference

ath:AT1G21970

ath:AT2G37060

ath:AT3G53340

ath:AT5G47670

osa:9268669

These KEGG gene identifiers are linked through homologous proteins; they do not establish pathway function for this gene.

Open Annotation Module

Gene expression

View expression in different studies, tissues and treatments. Results are presented separately by study and measurement unit.

View expression for this gene

Data sources and gene correspondence

Expression data come from public transcriptome studies. Reference genomes, sample metadata and measurement units are shown with the results. Ambiguous cross-reference correspondences do not select an expression record automatically; missing values do not mean zero expression.

Subcellular Localization Top 5

Computational predictions or homology annotations below do not replace localization experiments.

Nucleus0.963

Rank 1 · TkA07G022320 · TK1151

Cytoplasm0.126

Rank 2 · TkA07G022320 · TK1151

Cell membrane0.017

Rank 3 · TkA07G022320 · TK1151

Endoplasmic reticulum0.010

Rank 4 · TkA07G022320 · TK1151

Mitochondrion0.008

Rank 5 · TkA07G022320 · TK1151

LocPro · Direct prediction · Computational prediction, not experimental localization

Open Subcellular Module

Predicted Functional Domains

Domain results are from Pfam-A/HMMER; positions are amino-acid coordinates on the protein sequence.

PF06798PrkA39-102 aa

PF00125Histone44-109 aa

PF00808CBFD_NFYB_HMF45-109 aa

PF15511CENP-T_C46-109 aa

PF02269TFIID-18kDa68-111 aa

PF07524Bromo_TP69-114 aa

Gene ID	Domain ID	Domain Name	Start aa	End aa	E-value	Score
TkA07G022320	`PF06798`	PrkA	39	102	0.27	11.6
TkA07G022320	`PF00125`	Histone	44	109	4.4e-06	27.7
TkA07G022320	`PF00808`	CBFD_NFYB_HMF	45	109	8.1e-27	94.0
TkA07G022320	`PF15511`	CENP-T_C	46	109	0.041	14.7
TkA07G022320	`PF02269`	TFIID-18kDa	68	111	0.0035	18.0
TkA07G022320	`PF07524`	Bromo_TP	69	114	0.17	12.6

Arabidopsis / Rice Protein Homology

Only Arabidopsis and rice are shown. Swiss-Prot entries are reviewed; TrEMBL entries are supplementary sequence candidates. Similarity is not experimental validation.

Download current result

Protein	Organism	Description	Identity	Database	Confidence
`Q84W66`	Arabidopsis thaliana	sp\|Q84W66\|NFYB6_ARATH Nuclear transcription factor Y subunit B-6	67.100%	Swiss-Prot	Medium
`Q9SFD8`	Arabidopsis thaliana	sp\|Q9SFD8\|NFYB9_ARATH Nuclear transcription factor Y subunit B-9	71.000%	Swiss-Prot	Medium
`Q67XJ2`	Arabidopsis thaliana	sp\|Q67XJ2\|NFYBA_ARATH Nuclear transcription factor Y subunit B-10	57.900%	Swiss-Prot	Medium
`Q8VYK4`	Arabidopsis thaliana	sp\|Q8VYK4\|NFYB8_ARATH Nuclear transcription factor Y subunit B-8	58.300%	Swiss-Prot	Medium
`Q9SLG0`	Arabidopsis thaliana	sp\|Q9SLG0\|NFYB1_ARATH Nuclear transcription factor Y subunit B-1	64.500%	Swiss-Prot	Low

JBrowse

View in Genome Browser

Gene Card